Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

NRPS-PKS hybrid protein capable of generating flavonoid compounds in fungi as well as encoding gene and application of hybrid protein

A technology of flavonoids and hybrid proteins, which is applied in the field of genetic engineering, can solve the problem that there is no report to prove that the synthetic genes of flavonoids are found, and achieve the effect of enriching sources

Pending Publication Date: 2020-10-16
INST OF MICROBIOLOGY - CHINESE ACAD OF SCI
View PDF4 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0006] But at present, there is only one case of flavonoids isolated from fungi (Biosynthesis of Chlorflavonin in Aspergillus candidus: A Novel Fungal Route to Flavonoids.J.C.S.CHEM.COMM., 1979), and there is no report to prove that flavonoids are found in fungi synthetic gene

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • NRPS-PKS hybrid protein capable of generating flavonoid compounds in fungi as well as encoding gene and application of hybrid protein
  • NRPS-PKS hybrid protein capable of generating flavonoid compounds in fungi as well as encoding gene and application of hybrid protein
  • NRPS-PKS hybrid protein capable of generating flavonoid compounds in fungi as well as encoding gene and application of hybrid protein

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0038]Example 1 Construction of heterologous expression strain of PFICI_04360 gene in Aspergillus nidulans

[0039] Aspergillus nidulans LO8030 was used as the starting strain for genetic modification in this example.

[0040] The gene PFICI_04360 (as shown in SEQ ID NO.2) used in this example comes from Pestalotiopsis fici CGMCC3.15140, using the genome of Pestalotiopsis fici as a template, using high-fidelity enzymes and the following primers for PCR amplification It was divided into 3 segments for cloning, each segment contains about 150bp overlap sequence.

[0041] name Oligonucleotide sequence(5'-3') PF4360-1for ttcagtatattcatcttcccatccaagaacctttaatcgggcagttcacctccttgacc 4360-R1 ggaggatccaagaccaagatg 4360-F2 gactggttgcttcattggcacg 4360R2 ggagaatggcagtcgaatctgg 4360F3 gtcagcacgacaacgagctc PF4360-3rev cacaacatatttcgtcagacacagaataactctcgctagcgtgctaattccgacaagcc

[0042] Then use the yeast assembly technology (see the lit...

Embodiment 2

[0044] Example 2 HPLC verification of PFICI_04360 gene heterologous expression product in Aspergillus nidulans

[0045] In order to verify the product of gene heterologous expression, the PFICI_04360 heterologous expression strain obtained in Example 1 and Aspergillus nidulans LO8030 were respectively added to rice culture medium (80g rice, 1.2g YE, 115mL water were added in each 500mL Erlenmeyer flask, auxotrophic Added according to the genotype of the mutant strain, cultured at 25°C for 12 days in 121°C high-pressure steam sterilization (30mim), and then carried out compound extraction, and the extracted compound was used to detect the heterogeneity of PFICI_04360 in Aspergillus nidulans by high-performance liquid chromatography HPLC analysis method source expression product. see results image 3 and Figure 4 .

[0046] The extraction was carried out under the following conditions: the mycelium and the culture medium obtained after culturing for 12 days were subjected to...

Embodiment 3

[0050] Example 3 Isolation, purification and identification of the heterologous expression product of PFICI_04360 gene in Aspergillus nidulans - naringenin chalcone

[0051] In order to further confirm the heterologous expression products in Aspergillus nidulans, the PFICI_04360 heterologous expression strain obtained in Example 1 was fermented and cultured in rice medium. First, the strain was inoculated into GMM by streaking (supplementing corresponding nutritional deficiencies), and cultured statically for 3 days under dark conditions at 37°C. After sporulation, 0.1% Tween 80 was used to help moisten the spores, and the mycelium was filtered through a filter cloth to make a spore suspension. liquid. Add 80g of rice, 1.2g of YE, and 115mL of water into each 500mL Erlenmeyer flask, add nutritional deficiencies according to the genotype of the mutant strain, and sterilize with high pressure steam at 121°C for 30mim. Inoculate 2.5×10 rice medium in each bottle 7 spores were c...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
concentrationaaaaaaaaaa
Login to View More

Abstract

The invention discloses NRPS-PKS hybrid protein capable of generating flavonoid compounds in fungi as well as an encoding gene and an application of the hybrid protein, and relates to NRPS-PKS hybridprotein, a vector, recombinant bacteria and a preparation method of the protein and flavonoid compounds of the hybrid protein. The amino acid sequence of the NRPS-PKS hybrid protein is shown as SEQ IDNO: 1. When the NRPS-PKS hybrid protein is subjected to heterologous expression, flavonoid compounds, namely naringenin chalcone and naringenin, can be generated.

Description

technical field [0001] The present invention generally relates to the technical field of genetic engineering, and specifically relates to the preparation method of NRPS-PKS hybrid protein, carrier, recombinant bacteria and protein and flavonoids. Background technique [0002] Fungi are the second largest group of organisms in nature, and their secondary metabolites are an important source of natural medicines. Fungal secondary metabolites that have been used in clinical treatment include penicillin, griseofulvin, cyclosporine A, lovastatin and alkaloids. Its synthases are mainly divided into four categories: polyketide synthases (Polyketide synthases, PKSs), non-ribsomal peptide synthases (NRPSs), terpene synthases / cyclases (Terpene synthases / cyclases, TCs) and Dimethylallyl tryptophan synthases (DMATSs). In addition, there is a class of PKS and NRPS hybrid enzymes in fungi that can also catalyze the production of secondary metabolites. Hybrid enzymes are divided into two...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N9/00C12N15/81C12N15/80C12N1/15C12N1/19C12P17/06C12R1/66C12R1/865
CPCC12N9/00C12N15/81C12N15/80C12P17/06
Inventor 尹文兵周爽张宏娇李自馨
Owner INST OF MICROBIOLOGY - CHINESE ACAD OF SCI
Features
  • Generate Ideas
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More