Method for preparing raspberry ketone by whole-cell transformation

A technology of whole cell transformation and raspberry ketone, applied in the field of genetic engineering, can solve the problems of complex preparation method, long fermentation time, equipment corrosion, etc., and achieve the effects of environmental protection, high transformation efficiency and low energy consumption in the preparation process

Active Publication Date: 2020-12-25
JIANGNAN UNIV
View PDF2 Cites 1 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0004] Among them, there are many chemical synthesis paths of raspberry ketone, but there are mainly three kinds in production: Albertus et al. use methyl vinyl ketone and phenol as raw materials and strong acid as a catalyst to synthesize raspberry ketone, and then extract, distill, and regenerate After operations such as crystallization, the finished product of raspberry ketone is obtained, and the yield is about 69%. However, the preparation method of the raw material methyl vinyl ketone used in the synthesis process is particularly complicated and highly toxic, and has not been widely promoted; Butanol ketone is used as a raw material, and the alkylation reaction is carried out under acid catalysis to generate raspberry ketone. Butanol ketone can be used to replace toxic methyl vinyl ketone, but butanol ketone is easy to lose water during the reaction to generate methyl vinyl ketone. Accompanied by the generation of other by-products, and this reaction also requires strong acid and low temperature conditions, and there are also problems such as environmental pollution and equipment corrosion; the Claisen-Schmidt condensation method uses p-hydroxybenzaldehyde and acetone to condense and then hydrogenate The reduction reaction generates raspberry ketone. This method has high yield and good product quality, but it will also cause problems such as equipment corrosion and environmental pollution.
[0005] The biological synthesis of raspberry ketone is still in the laboratory stage; in 1998, Fuganti et al. used 14 different microorganisms to reduce p-hydroxybenzylidene acetone, and the production of raspberry ketone could be detected (Journal of Molecular Catalysis B Enzymatic, 1998); In 2007, Beekwilder et al. further introduced p-coumaric acid from tobacco based on the activity of benzylacetone reductase in E. coli: CoA ligase and chalcone synthase from raspberry were expressed in E. coli and yeast expression systems In Escherichia coli, raspberry ketone only reached a yield of 5 mg / L (Biochemical Journal, 2006); in 2019, Wang Chengcheng et al overexpressed a plant-derived 4-coumaroyl-CoA ligase, The three genes of benzylacetone synthase and benzylacetone reductase, by adding p-coumaric acid to the fermentation medium, only obtained a yield of 178 mg / L raspberry ketone (Applied Microbiology and Biotechnology, 2019); it can be seen that the above The concentration of raspberry ketone produced by fermentation is generally not high, and the fermentation time is long; the expression of various heterologous proteins increases the metabolic burden of Escherichia coli, and the precursor substrates and metabolic intermediates are toxic to cells. It is beneficial to the growth of bacteria and the transformation of precursor substrates, but it cannot meet the production requirements

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method for preparing raspberry ketone by whole-cell transformation
  • Method for preparing raspberry ketone by whole-cell transformation
  • Method for preparing raspberry ketone by whole-cell transformation

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0058]Example 1: Construction of a recombinant plasmid containing the glucose dehydrogenase gene sygdh

[0059]Specific steps are as follows:

[0060]The codon-optimized nucleotide sequence of the glucose dehydrogenase gene sygdh shown in SEQ ID NO. 2 was used as a template, and sygdh-F and sygdh-R were used as primers for PCR amplification; PCR reaction conditions were: 90 -95°C pre-denaturation for 3 to 5 minutes, 94°C denaturation for 30 to 45 seconds, 55°C annealing for 30 to 45 seconds, 70 to 72°C extension for 1 minute, 30 cycles, 70 to 72°C fully extended for 5 to 10 minutes.

[0061]After the PCR reaction, the PCR product was detected by agarose gel electrophoresis, and the gel was cut to recover the glucose dehydrogenase gene sygdh. The primers are:

[0062]sygdh-F: GGATCCATGACCGAACAGAAAG (SEQ ID NO. 3)

[0063]sygdh-R: AAGCTTGCGGGCCGCTTACTGC (SEQ ID NO. 4)

[0064]Connect the glucose dehydrogenase gene sygdh obtained in the above steps to the vectors pETDuet-1, pACYCDuet-1, pCDFDuet-1 and p...

Embodiment 2

[0065]Example 2: Construction of a recombinant plasmid containing the glucose dehydrogenase gene sygdh and the benzylacetone reductase gene rirzs1

[0066]Specific steps are as follows:

[0067]The benzylacetone reductase gene rirzs1 with the codon-optimized nucleotide sequence shown in SEQ ID NO. 1 was used as a template, and rirzs1-F, rirzs1-R were used as primers for PCR amplification; the PCR reaction conditions were: 90-95°C pre-denaturation for 3 to 5 minutes, 94°C denaturation for 30 to 45 seconds, 55°C annealing for 30 to 45 seconds, 70 to 72°C extension for 1 minute, 30 cycles, 70 to 72°C fully extended for 5 to 10 minutes.

[0068]After the PCR reaction, the PCR product was detected by agarose gel electrophoresis, and the gel was cut to recover the benzylacetone reductase gene rirzs1. The primers are:

[0069]rirzs1-F: AGATCTATGGCCAGCGGC (SEQ ID NO.5)

[0070]rirzs1-R: GGTACCTTATTCACGGCTAACCA (SEQ ID NO.6)

[0071]The benzylacetone reductase gene rirzs1 obtained in the above steps is ligate...

Embodiment 3

[0072]Example 3: Construction of recombinant E. coli co-expressing benzylacetone reductase and glucose dehydrogenase

[0073]Specific steps are as follows:

[0074](1) The recombinant plasmids pET-sygdh-rirzs1, pACYC-sygdh-rirzs1, pCDF-sygdh-rirzs1 and pRSF-sygdh-rirzs1 constructed in Example 2 were respectively transferred into E. coli BL21 (DE3) competent cells to obtain Single plasmid recombinant engineering strains BL21 / pET-sygdh-rirzs1, BL21 / pACYC-sygdh-rirzs1, BL21 / pCDF-sygdh-rirzs1 and BL21 / pRSF-sygdh-rirzs1.

[0075](2) Construction of recombinant engineering strains containing dual plasmid expression vectors pET20b(+)-rirzs1 and pET28a(+)-sygdh

[0076]Reduce the glucose dehydrogenase gene sygdh with the codon-optimized nucleotide sequence as shown in SEQ ID NO.2 and the codon-optimized nucleotide sequence as the benzylacetone shown in SEQ ID NO.1 The enzyme gene rirzs1 was used as a template, and sygdh-F-Nco I, sygdh-R-Xho I, rirzs1-F-Nde I, and rirzs1-R-Kpn I were used as primers for...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
concentrationaaaaaaaaaa
Login to View More

Abstract

The invention discloses a method for preparing raspberry ketone by whole-cell transformation, and belongs to the technical field of gene engineering. According to the method, recombinant engineering bacteria for co-expression of benzylacetone reductase and glucose dehydrogenase genes are used as biocatalysts, p-hydroxybenzalacetone is used as a substrate, a permeable microbial whole-cell self-circulation NADPH donor system is utilized to synthesize raspberry ketone, and the concentration of raspberry ketone can be as high as 9.4 g.L<-1> after reaction for 1 h at 45 DEG C in a 50 mL system. Thedefects of high pollution of chemical synthesis, non-biological source, low yield of a biological fermentation method, low production efficiency and the like are overcome, and a method for efficiently synthesizing the raspberry ketone by a biological method is provided.

Description

Technical field[0001]The invention relates to a method for preparing raspberry ketone by using whole cell transformation, and belongs to the technical field of genetic engineering.Background technique[0002]Raspberry ketone was first extracted from raspberry fruit. It is the main aroma component of raspberry fruit. It has a characteristic sweet fruit aroma. Natural raspberry ketone is generally extracted from plants, such as raspberry, blackberry, and raspberry fruit. The output is small and the price is expensive, about 3000 US dollars per kilogram. The raspberry ketone commonly used in the market is synthesized from the fossil fuel p-hydroxybenzaldehyde and acetone. Nowadays, in the perfume industry, raspberry ketone has become a kind of perfume with extremely high economic value, second only to vanillin. Raspberry ketone is widely used in edible flavors, cosmetics, insect attractants, medicine, etc. due to its unique fruity aroma. The acetate of raspberry ketone (4-p-acetoxyphenyl...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C12N1/21C12N15/70C12N15/53C12P7/26C12R1/19
CPCC12N9/0006C12N15/70C12P7/26C12Y101/01049
Inventor郑璞杨波吴丹陈鹏程
OwnerJIANGNAN UNIV