CRISPR system and application thereof in constructing LRP5 gene mutation osteoporosis cloned pig nuclear donor cell

A gene and gene editing technology, applied in the field of gene editing, can solve the problems of low probability of homozygous mutant offspring and inapplicability, and achieve the effect of improving nuclear localization ability, good applicability, and increasing the number of nuclear localization signals

Active Publication Date: 2021-03-19
NANJING KGENE GENETIC ENG CO LTD
View PDF2 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

For example, the method of embryo transfer after microinjection of gene editing materials into fertilized eggs used in the production of mouse models, because the probability of directly obtaining homozygous mutant offspring is very low (less than 5%), hybrid selection of offspring is required. breeding, which is less suitable for modeling large animals (such as pigs) with long gestation periods

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • CRISPR system and application thereof in constructing LRP5 gene mutation osteoporosis cloned pig nuclear donor cell
  • CRISPR system and application thereof in constructing LRP5 gene mutation osteoporosis cloned pig nuclear donor cell
  • CRISPR system and application thereof in constructing LRP5 gene mutation osteoporosis cloned pig nuclear donor cell

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1Ca

[0074] The construction of embodiment 1 Cas9 high-efficiency expression vector and the construction of pKG-U6gRNA vector

[0075] 1.1 Construction of pU6gRNA-eEF1a-mNLS-hSpCas9-EGFP-PURO (Cas9 high-efficiency expression vector)

[0076] (1) Remove redundant and invalid sequences in the gRNA backbone

[0077] pX330-U6-Chimeric_BB-CBh-hSpCas9 (referred to as pX330, figure 1 ) was digested with BbsI and XbaI, and the vector fragment (about 8313bp) was recovered, and the insert fragment 175bp (SEQ ID NO: 31) was synthesized by the multi-fragment recombination method, and recombined with the recovered vector fragment to obtain the pU6gRNACas9 vector ( figure 2 ).

[0078] (2) Transformation of promoters and enhancers

[0079] For the constructed pU6gRNACas9 vector, use XbaI and AgeI endonucleases to remove the promoter (chickenβ-actin promoter) and enhancer sequence (CMV enhancer), recover the linear vector sequence of about 7650bp, and use the multi-fragment recombination meth...

Embodiment 2

[0094] Example 2 Plasmid Proportion Optimization and Effect Comparison of Plasmid pX330 and Plasmid pKG-GE3

[0095] 2.1 gRNA target design and construction

[0096] 2.1.1 Using Benchling to design gRNA targets for the RAG1 gene

[0097] RAG1-gRNA4: AGTTATGGCAGAACTCAGTG (SEQ ID NO: 4)

[0098] The insert sequence complementary DNA oligo of the synthetic RAG1 gene is as follows:

[0099] RAG1-gRNA4S: caccgAGTTATGGCAGAACTCAGTG (SEQ ID NO: 5)

[0100] RAG1-gRNA4A: aaacCACTGAGTTCTGCCATAACTc (SEQ ID NO: 6)

[0101] Both RAG1-gRNA4S and RAG1-gRNA4A are single-stranded DNA molecules.

[0102] 2.1.2 Primers designed to amplify the fragment containing the RAG1 gRNA target

[0103] RAG1-nF126: CCCCATCCAAAGTTTTTAAAGGA (SEQ ID NO: 7)

[0104] RAG1-nR525: TGTGGCAGATGTCACAGTTTAGG (SEQ ID NO: 8)

[0105] 2.1.3 The method of cloning the gRNA sequence into the pKG-U6gRNA backbone vector

[0106] 1) Digest 1ug pKG-U6gRNA plasmid with restriction endonuclease BbsI;

[0107] 2) run the d...

Embodiment 3

[0155] Example 3 Design and construction of LRP5 gene target

[0156] 3.1 Genomic DNA extraction

[0157] 18 pigs (male A, B, C, D, E, F, G, H female 1, 2, 3, 4, 5) were respectively performed using Vazyme's FastPure Cell / Tissue DNA Isolation Mini Kit (VazymeCat.DC102-01). , 6, 7, 8, 9, 10) Genomic DNA from ear tissue was extracted by column, quantified using NanoDrop, and stored at -20°C for future use.

[0158] 3.2 Conservation analysis of predetermined targets of LRP5 gene knockout and adjacent genome sequences

[0159] 3.2.1 Gene information of pig LRP5

[0160] Encodes LDL receptor-associated protein 5; located on chromosome 2; GeneID is 100524299, Sus scrofa. The amino acid sequence encoded by the pig LRP5 gene is shown in SEQ ID NO:10. Existing research results have shown that LRP5 plays a central role in bone mass regulation. In pig genomic DNA, the LRP5 gene has 25 exons, of which the sixth exon occupies an important position in all transcripts (porcine LRP5 gene ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a CRISPR / Cas9 system and application thereof in constructing an LRP5 gene mutation osteoporosis cloned pig nuclear donor cell. The CRISPR / Cas9 system for editing a pig LRP5 gene comprises a Cas9 expression vector and a gRNA expression vector for the pig LRP5 gene; and the Cas9 expression vector is pU6gRNA-eEF1a-mNLS-hSpCas9-EGFP-PURO with a plasmid complete sequence as shown in SEQ ID NO.1. The Cas9 efficient expression vector jointly modified by the screened gRNA is adopted for gene editing, and the editing efficiency is higher than that of an original vector by 100% or above. A solid foundation is laid for preparation of an osteoporosis pig model, and treatment of the disease and pathogenesis research are facilitated.

Description

technical field [0001] The invention belongs to the technical field of gene editing, and in particular relates to a CRISPR / cas9 system and its application in the construction of cloned pig nucleus donor cells for osteoporosis with LRP5 gene mutation. Background technique [0002] Osteoporosis (OP) is caused by an imbalance between bone resorption and bone formation, a systemic bone metabolic disease characterized by low bone mass and microarchitectural destruction of bone tissue, increased bone fragility, and susceptibility to fracture . Modern medicine divides osteoporosis into three categories: primary, secondary, and idiopathic osteoporosis. Primary osteoporosis is a sudden reduction of sex hormones and physiological degenerative changes caused by age, and is divided into type I postmenopausal osteoporosis and type II senile osteoporosis. Secondary osteoporosis, induced by disease or drug factors, such as endocrine and metabolic diseases (diabetes, hyperthyroidism), kid...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/85C12N15/62C12N15/12C12N15/113C12N5/10
CPCC12N15/85C12N15/8509C12N15/1138C12N5/0656C12N9/22C07K14/705C12N2310/20C12N2510/00C12N2800/107A01K2267/0306A01K2227/108C12N2830/48C12N2830/50C07K2319/09C07K2319/60C07K2319/00
Inventor牛冬汪滔陶裴裴曾为俊王磊程锐马翔赵泽英刘璐黄彩云
OwnerNANJING KGENE GENETIC ENG CO LTD