Long-range PCR (Polymerase Chain Reaction) method and kit for detecting polymorphism variation of CYP2D6 gene
A gene polymorphism and kit technology, applied in the direction of DNA / RNA fragments, biochemical equipment and methods, recombinant DNA technology, etc., can solve the problem that the initial DNA quantity of the sample to be tested is high and cannot be evaluated more comprehensively and accurately Risk of variation, judgment and interpretation of impact results, etc.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0046] Example 1 Long-range PCR method for detecting polymorphic variation of CYP2D6 gene
[0047] 1. Primer Design
[0048] The upstream, downstream and nearby sequences of CYP2D6 gene were extracted from NCBI or UCSC, and Primer5.0 was used to design specific amplification primers. The forward primer was CCAGAGAGGTAGCCAGTCCT, and the reaction primer was TGATCCCATAGAAGTCCAGAGC. Other specific amplification products were also used in this patent. The designed specific primers were combined with nested PCR and sanger sequencing to verify that the primers specifically amplified the CYP2D6 gene.
[0049] 2. DNA extraction
[0050] The collected clinical samples are subjected to DNA extraction, and the extraction method can be a magnetic bead extraction method or a commercial column extraction method. The concentration of extracted DNA is checked by ThermoNanoDrop micro-volume ultraviolet spectrophotometer or Qubit fluorometer. The ratio of A260 / A280 measured by NanoDrop should ...
Embodiment 2
[0089] Example 2 The Long-range PCR kit for the CYP2D6 gene polymorphic variation of the detection method of the present invention and its use example
[0090] The genomic DNA was extracted from the oral swab samples collected from the patients to be tested. After the quality inspection and concentration determination of the extracted DNA, the full-length CYP2D6 gene was amplified with a Long-range PCR kit for polymorphic variation of the CYP2D6 gene.
[0091] Take 1~50ng of genomic DNA of the sample to be tested and configure the reaction solution according to the following system, and take 20ng of positive control sample DNA for parallel experiments.
[0092]
[0093] After the configured PCR reaction system was thoroughly vortexed and briefly centrifuged, the PCR tube was placed on the PCR machine and the PCR program was run.
[0094]
[0095] Perform agarose gel electrophoresis quality inspection on the PCR amplification product: configure 0.5% agarose gel, take 2 μl...
PUM

Abstract
Description
Claims
Application Information

- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com