Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Long-range PCR (Polymerase Chain Reaction) method and kit for detecting polymorphism variation of CYP2D6 gene

A gene polymorphism and kit technology, applied in the direction of DNA / RNA fragments, biochemical equipment and methods, recombinant DNA technology, etc., can solve the problem that the initial DNA quantity of the sample to be tested is high and cannot be evaluated more comprehensively and accurately Risk of variation, judgment and interpretation of impact results, etc.

Pending Publication Date: 2021-07-30
THE SECOND HOSPITAL AFFILIATED TO SUZHOU UNIV
View PDF6 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

The high cost of liquid phase hybridization chip is not suitable for popularization and application
And there are highly homologous regions on the genome in some regions of the gene. When primers or probes are designed for detection of sites in this part of the region, it is easy to be interfered by the homologous regions of the genome, thus affecting the judgment and interpretation of the results.
Moreover, most of the testing products currently have higher requirements for the initial DNA amount of the sample to be tested.
[0006] Chinese patent 201611107790.9 discloses a nucleic acid, kit and method for rapid detection of CYP2D6 gene polymorphism, specifically for the detection of site polymorphisms of CYP2D6*10 gene C100T and G4268C, CYP2D6*14 gene G1758A, However, the entire gene sequence has not been amplified and detected, so it is impossible to more comprehensively and accurately assess the risk of mutation

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Long-range PCR (Polymerase Chain Reaction) method and kit for detecting polymorphism variation of CYP2D6 gene
  • Long-range PCR (Polymerase Chain Reaction) method and kit for detecting polymorphism variation of CYP2D6 gene
  • Long-range PCR (Polymerase Chain Reaction) method and kit for detecting polymorphism variation of CYP2D6 gene

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0046] Example 1 Long-range PCR method for detecting polymorphic variation of CYP2D6 gene

[0047] 1. Primer Design

[0048] The upstream, downstream and nearby sequences of CYP2D6 gene were extracted from NCBI or UCSC, and Primer5.0 was used to design specific amplification primers. The forward primer was CCAGAGAGGTAGCCAGTCCT, and the reaction primer was TGATCCCATAGAAGTCCAGAGC. Other specific amplification products were also used in this patent. The designed specific primers were combined with nested PCR and sanger sequencing to verify that the primers specifically amplified the CYP2D6 gene.

[0049] 2. DNA extraction

[0050] The collected clinical samples are subjected to DNA extraction, and the extraction method can be a magnetic bead extraction method or a commercial column extraction method. The concentration of extracted DNA is checked by ThermoNanoDrop micro-volume ultraviolet spectrophotometer or Qubit fluorometer. The ratio of A260 / A280 measured by NanoDrop should ...

Embodiment 2

[0089] Example 2 The Long-range PCR kit for the CYP2D6 gene polymorphic variation of the detection method of the present invention and its use example

[0090] The genomic DNA was extracted from the oral swab samples collected from the patients to be tested. After the quality inspection and concentration determination of the extracted DNA, the full-length CYP2D6 gene was amplified with a Long-range PCR kit for polymorphic variation of the CYP2D6 gene.

[0091] Take 1~50ng of genomic DNA of the sample to be tested and configure the reaction solution according to the following system, and take 20ng of positive control sample DNA for parallel experiments.

[0092]

[0093] After the configured PCR reaction system was thoroughly vortexed and briefly centrifuged, the PCR tube was placed on the PCR machine and the PCR program was run.

[0094]

[0095] Perform agarose gel electrophoresis quality inspection on the PCR amplification product: configure 0.5% agarose gel, take 2 μl...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides a long-range PCR (Polymerase Chain Reaction) method and kit for detecting polymorphism variation of a CYP2D6 (Cytochrome Phosphate 2D6) gene. The method comprises the following steps: step 1, genome DNA extraction; step 2, specific amplification of the CYP2D6 gene by an LR-PCR method; step 3, purification of an amplification product; and step 4, construction of a product library. Compared with multiple PCR detection, the detection method does not need to design a plurality of pairs of special primers, reduces the amplification of non-specific bands in the PCR process, and effectively enriches the polymorphic variation bands. Under the primer amplification condition, the band of the amplified result is clear and single. Compared with a customized chip hybridization capture technology, Long-range PCR can obviously shorten the time and greatly reduce the cost.

Description

technical field [0001] The invention relates to the field of biotechnology, in particular to a Long-range PCR method, primer set and kit for detecting polymorphic variation of CYP2D6 gene. Background technique [0002] The CYP2D6 metabolizing enzyme is a member of the cytochrome P450 family, a monooxygenase that catalyzes many reactions involved in drug metabolism and synthesis of cholesterol, steroids, and other lipids. Localized to the endoplasmic reticulum, this protein metabolizes up to 25% of commonly used drugs. Its substrates include antidepressants, antipsychotics, analgesics and antitoxics, beta-adrenergic blockers, antiarrhythmics and antiemetics. CYP2D6 is the only enzyme that cannot be induced in all cytochrome P450 gene families involved in drug metabolism. This enzyme has a wide range of polymorphisms and this polymorphism has an important impact on the drug metabolism function of the enzyme. The polymorphism of CYP2D6 and the difference in individual activit...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12Q1/6858C12N15/11
CPCC12Q1/6858C12Q2531/113C12Q2535/122C12Q2521/501
Inventor 张荣凌莉李文沈孝青鲁锦邱丽君
Owner THE SECOND HOSPITAL AFFILIATED TO SUZHOU UNIV
Features
  • Generate Ideas
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More