A Genetically Engineered Bacteria Using 1,4-Butanediol to Produce Mono-rhamnolipid and Its Application
A technology of genetically engineered bacteria and butanediol, applied in the biological field, can solve the problems of safety and cannot be applied in large-scale industrialization, and achieve the effect of improving safety
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0027] This example specifically illustrates Pseudomonas putida ( Pseudomonas putida ) Screening method for NB10.
[0028] ARTP mutagenesis
[0029] Under the conditions of normal temperature and pressure, the ARTP device uses a plasma generator to achieve stable glow discharge of helium gas through a metal electrode structure. The generated plasma damages the genes of the recipient bacteria and induces mutations.
[0030] Pseudomonas putida KT2440 was streaked on LB solid medium, cultured at 30°C for 18h, and single bacteria were picked and inoculated into a 5mL liquid LB test tube, and cultured overnight at 30°C, 200 r / min shaking. Centrifuge at 4°C, 5000r / min for 10min, resuspend in M9 medium without carbon source, inoculate 3% inoculum in 50mL M9 liquid shake flask containing 3.6 g / L glucose, 30°C, 200r / min, shake Cultured to log phase.
[0031] Dilute the above bacterial solution with physiological saline (0.85%) to OD 600 = 1, spread 10 μL of bacterial solution even...
Embodiment 2
[0037] Example 2 Construction method of Pseudomonas putida engineering bacteria
[0038] 1. Cloning of key genes for rhamnolipid synthesis
[0039] Primers were designed according to the sequence of rhamnolipid synthesis-related gene cluster (rhlIRBA), and the forward primer was 5'- GACTC ACTATAGGGCGAATTGGAGCT CCCGTCCTGTGAAATCTGGCA-3', the 5' end of the primer introduces a 26bp homology arm (upstream of the SacI restriction site in pBBRmcs-5, underlined); 5'- CGGTATCGATAAGCTTGATATCGAATTCGAGCATGCGGCAGGAGAAGCG-3', a 26bp homology arm was introduced at the 5' end of the primer (downstream of the EcoRI restriction site in pBBRmcs-5, underlined). Pseudomonas aeruginosa P. aeruginosa KT1115 genomic DNA was used as the template to amplify the complete sequence of rhamnolipid synthesis-related gene cluster (rhlIRBA). The rhlIRBA nucleotide sequence is shown in SEQ ID NO:1.
[0040] 2. Construction of rhamnolipid production plasmid
[0041] The expression plasmid vector used...
Embodiment 3
[0046] Example 3 Fermentation verification of rhamnolipid-producing Pseudomonas putida engineered bacteria
[0047] 1. Fermentation process control
[0048] The strains were streaked on LB solid medium containing 30 mg / L gentamicin, and cultured at 30°C for 18 h. Pick out Pseudomonas putida engineering bacteria NB10-pBBRmcs5-rhlIRBA single bacteria and inoculate it in 5mL liquid LB test tube containing 30mg / L gentamicin, 30 ℃, 200r / min shaking culture overnight, according to 1% of the inoculum inoculation In 50mL liquid LB shake flask containing 30mg / L gentamicin, 30℃, 200r / min, shaking culture to log phase.
[0049] The formula of LB solid medium is: yeast powder 5g / L, peptone 10g / L, NaCl 10g / L, agar powder 15g / L, and water is added to make up the volume; LB medium formula is: yeast powder 5g / L, peptone 10g / L, NaCl 10g / L, add water to make up the volume.
[0050] The above-mentioned cultivated strains were inoculated into 500mL shake flasks containing 100mL fermentation me...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More