Recombinant rhamnolipid-producing strain and application thereof

A technology for producing rhamnolipids and bacteria, which is applied in the fields of applied microorganisms and genetic engineering, and can solve the problems of limiting the large-scale application of rhamnolipids, high fermentation costs, and low yields of rhamnolipids

Pending Publication Date: 2021-09-07
SHENYANG INST OF APPLIED ECOLOGY - CHINESE ACAD OF SCI
View PDF5 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0003] At present, the application problem of rhamnolipids is that the market price of rhamnolipids is much higher than that of cheap chemically synthesized surfactants due to the low yield and high fermentation cost, thus limiting the large-scale application of rhamnolipids

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Recombinant rhamnolipid-producing strain and application thereof
  • Recombinant rhamnolipid-producing strain and application thereof
  • Recombinant rhamnolipid-producing strain and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0023] Example 1: Construction of the plasmid pBBR1MCS-5-vgb expressing hemoglobin

[0024] Using primers vgb-f: CGCGGATCCGGAAGACCCTCATGTTAGA, vgb-r: ATTATCTAGATTATTCAACCGCTTGAGCGTA, the complete vgb gene fragment was obtained by PCR from Hyacinthus faecalis (ATCC 15218), and the fragment was ligated into the cloning vector pMD19-T to obtain the recombinant vector pMD19- T-vgb.

[0025] Use BamHI and SalI to double digest the plasmids pBBR1MCS-5 and pMD19-T-vgb. After digestion, use the kit to recover the large fragment after pBBR1MCS-5 digestion. pMD19-T-vgb cut the gel to recover the vgb fragment, and recover the two fragments Ligated by T4 ligase, the recombinant plasmid pBBR1MCS-5-vgb was obtained (see figure 1 ).

Embodiment 2

[0026] Embodiment 2: Construction of Pseudomonas aeruginosa engineered bacteria expressing hemoglobin

[0027] The recombinant plasmid pBBR1MCS-5-vgb in Example 1 was transformed into competent Pseudomonas aeruginosa by calcium chloride heat shock method, coated with LB solid plate containing 50 μg / mL gentamicin, and cultured at a constant temperature of 37°C until growth The transformants were verified by PCR to obtain Pseudomonas aeruginosa engineering bacteria expressing VHb. The specific method is as follows:

[0028] (1) Pseudomonas aeruginosa was inoculated into 5 mL of LB liquid medium for activation culture, and the culture conditions were 37° C., 180 rpm. (2) Dip the inoculated loop to pick up the activated bacterial solution, streak it on the LB plate, and incubate overnight at 37°C. (3) Pick out a single colony and inoculate it into LB liquid medium, and culture it at 37°C and 180rpm. (4) Transfer the culture solution obtained above to fresh LB liquid medium at a...

Embodiment 3

[0029] Example 3: Application of expressing hemoglobin in improving rhamnolipid production

[0030] Inoculate wild-type Pseudomonas aeruginosa and the hemoglobin-expressing bacterial strain obtained in Example 2 into 250mL Erlenmeyer flasks containing 100mL seed medium respectively, and the culture conditions are 37°C, 180rpm; each culture experiment is three parallel repeated experiments . The next day, the seed solution was inoculated into 250mL containing 150mL fermentation medium with an inoculation amount of 3wt%, cultivated for 7 days at 37°C, and the shaker speed was 180rpm. The experiment was three parallel experiments. Type Pseudomonas aeruginosa and engineering bacteria rhamnolipid production.

[0031] The fermentation medium is calculated by weight percentage, and the above seed medium is: 1.2% yeast powder, 2.4% peptone, 1% sodium chloride, and the balance is water; the fermentation medium is 2.5% glycerol, 1% soybean oil , nitrate 0.35%, phosphate 1.7%, sodium c...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to the technical field of applied microbiology and genetic engineering, and particularly relates to a recombinant rhamnolipid-producing strain and application thereof in fermentation production of rhamnolipids. According to the method in the invention, a hemoglobin gene vgb from Vitreoscilla stercoralis is connected to an expression vector to construct a recombinant vector PBBR1MCS-5-vgb, the recombinant expression vector is transformed into pseudomonas aeruginosa, the expression of hemoglobin promotes the growth of thalli and the synthesis of rhamnolipids, the ventilatory capacity and fermentation temperature required by fermentation are reduced, and a new technical scheme is provided for effectively reducing the fermentation production cost of rhamnolipids.

Description

technical field [0001] The invention relates to the technical field of applied microorganisms and genetic engineering, in particular to a recombinant rhamnolipid-producing bacterium and the application of the strain to produce rhamnolipid by fermentation. Background technique [0002] Rhamnolipids are secondary metabolites synthesized by microorganisms and belong to glycolipid biosurfactants. As a biosurfactant, rhamnolipid has excellent surface / interface activity, foaming, emulsification, demulsification, decontamination, solubilization, metal chelation, and good stability in extreme environments. Synthetic surfactants, rhamnolipids have low toxicity, are environmentally friendly, and are easy to degrade. They have broad application prospects in petroleum exploration, pollution control, agriculture, industry, food and other fields. [0003] At present, the application problem of rhamnolipids is that the market price of rhamnolipids is much higher than that of cheap chemica...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N1/21C12N15/31C12N15/78C12P19/44C12R1/385
CPCC07K14/195C12N15/78C12P19/44
Inventor张颖雷丽莹韩斯琴史荣久
OwnerSHENYANG INST OF APPLIED ECOLOGY - CHINESE ACAD OF SCI