Method for producing polyphosphate kinase 1 mutant through fermentation

A polyphosphate kinase and mutant technology, applied in the field of bioengineering, can solve problems affecting PPK1 enzyme activity, etc., and achieve the effects of improving production performance, increasing hydrophilicity, and increasing enzyme solubility

Pending Publication Date: 2022-07-05
XINTAI JIAHE BIOTECH CO LTD
View PDF8 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0004] However, the enzyme activity of existing PPK1 is generally around 650U/mg, which still needs to be further improved; and PPK1 is relatively strict on pH control. When producing 5'-monophosphate nucleotides (especially adenosine monophosph

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method for producing polyphosphate kinase 1 mutant through fermentation
  • Method for producing polyphosphate kinase 1 mutant through fermentation
  • Method for producing polyphosphate kinase 1 mutant through fermentation

Examples

Experimental program
Comparison scheme
Effect test

Example Embodiment

[0050] Example 1: Polyphosphate kinase 1 mutation treatment

[0051] The inventors obtained the amino acid sequence of wild-type polyphosphate kinase 1 from the existing database as shown in SEQ ID NO.1; the nucleotide sequence of the encoding gene is shown as SEQ ID NO.2. It is topologically and analyzed, the box is constructed, the energy is minimized under the charmm force field, then NVT equilibration and NPT equilibration are performed, 1ns MD simulation is performed on the finished product, and finally the wild-type polyphosphate kinase 1 position 246 is selected. L is mutated to P, and M at position 247 is mutated to V; the amino acid sequence of the mutated polyphosphate kinase 1 mutant is shown in SEQ ID NO.3.

[0052] The hydrophilicity of polyphosphate kinase 1 before and after mutation was analyzed by molecular dynamics simulation software, and the results were as follows figure 1 and figure 2 shown. The results showed that the hydrophilicity of the mutated pol...

Example Embodiment

[0053] Example 2: Construction of polyphosphate kinase 1 mutant-producing bacteria

[0054] (1) The pQE-60 plasmid was double digested with BspEⅠ and AflⅢ, and then ligated into a 124 bp fragment with the following sequence

[0055] TCCGGACTCGAGAAATCATAAAAAATTTATTTGCTTTGTGAGCGGATAACAATTATAATAGATTCAATTGTGAGCGGATAACAATTTCACACAGAATTCATTAAAGAGGAGAAATTAAGCATGC; (SEQ ID NO. 5)

[0056] Construction to obtain plasmid pQE-N (schematic diagram as shown in image 3 shown), and its nucleotide sequence is shown in SEQ ID NO.6.

[0057] (2) The plasmid pQE-N was double digested with AccIII and SphI, and the optimized ppk1 gene (nucleotide sequence shown in SEQ ID NO. 4) encoding the polyphosphate kinase 1 mutant was ligated into the digested On the plasmid, obtain the recombinant expression vector pQE-ppk1 (schematic diagram such as Figure 4 shown), and its nucleotide sequence is shown in SEQ ID NO.7.

[0058] The constructed recombinant expression vector pQE-ppk1 was digested with tw...

Example Embodiment

[0064] Example 3: Fermentative production of polyphosphate kinase 1 mutants

[0065] (1) Activation of strains:

[0066] The polyphosphate kinase 1 mutant-producing bacteria constructed in Example 2 were streaked into LB plates containing 100 μg / ml ampicillin, and cultured at 33° C. for 12 h.

[0067] (2) First-class species cultivation:

[0068] One inoculated loop of bacteria was drawn from the plate and placed in the primary seed medium, and cultured at 33°C, pH 7.0 for 16h.

[0069] (3) Secondary species cultivation:

[0070] Inoculate the primary seed liquid in the secondary seed medium with 1% (volume fraction) inoculation amount, and cultivate to OD at 33°C, dissolved oxygen (DO) 30-40% 600nm value 0.3 (100-fold dilution).

[0071] (4) Fermentation culture:

[0072] With 4% inoculation amount (that is, the access amount of the secondary seed liquid is 4% of the weight of the fermentation medium), inoculate the secondary seed liquid of the polyphosphate kinase 1 mut...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

No PUM Login to view more

Abstract

The invention discloses a method for producing a polyphosphate kinase 1 mutant by fermentation, which comprises the following steps: (1) inoculating a seed solution of polyphosphate kinase 1 mutant producing bacteria into a fermentation culture medium for fermentation culture, cooling to 21-23 DEG C when the OD600 value is 0.40-0.60 after the fermentation solution is diluted by 100 times, adding IPTG (isopropyl-beta-d-thiogalactoside) into the system for induced culture, carrying out induction culture for 20-24 hours; the residual sugar content of the system is monitored in the culture process, when the residual sugar content of the system is smaller than or equal to 1.0 g/L, supplementation is started, and the residual sugar concentration in the system is kept at 0.5-1.0 g/L through fed-batch supplementation; and (2) carrying out bacterium breaking treatment on the culture subjected to induction culture, separating and collecting supernatant, thereby obtaining the culture solution containing the polyphosphate kinase 1 mutant. According to the invention, the polyphosphate kinase 1 is subjected to mutation treatment, so that the enzyme activity of the polyphosphate kinase 1 is improved; and a fermentation production system of the polyphosphate kinase 1 mutant is constructed, so that industrial production of the polyphosphate kinase 1 mutant is realized.

Description

technical field [0001] The invention relates to the technical field of bioengineering, in particular to a method for producing a mutant of polyphosphate kinase 1 by fermentation. Background technique [0002] As a ubiquitous linear polymer, polyphosphate (poly P) is formed by the mutual polymerization of several to hundreds of phosphate residues through the same high-energy phosphate bond as ATP phosphoanhydride bond. In recent years, studies have found that poly P is not only an indispensable bioenergy and phosphate group reservoir, a biological macromolecule with high negative charge density, but also participates in the regulation of gene expression, regulation of bacterial ion channels and DNA uptake in microorganisms. , metabolism, etc., and are closely related to the regulation of transient potential in mammals, mitochondrial metabolism, cell calcification and other physiological processes. [0003] Polyphosphate kinase 1 (PPK1) is a key enzyme in the synthesis and me...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
IPC IPC(8): C12N9/12C12N15/70C12N15/54
CPCC12N9/1229C12N15/70C12Y207/04001
Inventor 岳明瑞谢沛曹华杰郭永胜
Owner XINTAI JIAHE BIOTECH CO LTD
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap