Unlock instant, AI-driven research and patent intelligence for your innovation.

Actinine fluorescent protein novel gene and its cloning, expression and use

A fluorescent protein and gene technology, applied in the field of new genes, can solve the problems of protein folding easily affected by temperature, lag, low gene expression, etc., and achieve the effect of high application prospect and industrial development value.

Inactive Publication Date: 2005-01-12
SUN YAT SEN UNIV
View PDF0 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Overcome some shortcomings of wild-type GFP, such as low fluorescence intensity at 470nm when excited by blue light, obvious lag in the process of protein biosynthesis of GFP and fluorescence generation through protein folding, complex photoisomerization, and protein folding are extremely susceptible The influence of temperature and the low expression of its genes in certain species of mammalian and plant cells are extremely unfavorable as reporter molecules

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Actinine fluorescent protein novel gene and its cloning, expression and use
  • Actinine fluorescent protein novel gene and its cloning, expression and use
  • Actinine fluorescent protein novel gene and its cloning, expression and use

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0079] Example 1 Extraction, library construction and PCR clone screening of the total RNA of the tentacle of the giant sea anemone

[0080] Extraction of total RNA and synthesis of cDNA: Dissect a giant sea anemone, collect 10 tentacles, use guanidine isothiocyanate method to extract total RNA from tentacles, and extract proteins with phenol / chloroform. Obtain 75 μg of total tentacles RNA, the A 260 / A 280 =1.9986, two clear bands of 28s and 18s can be seen by 1% formaldehyde denaturing gel electrophoresis, the ratio is >2, and mRNA smear, see figure 1 , indicating that the integrity of total RNA is good. Perform first-strand synthesis, LDPCR cDNA amplification, enzyme digestion and column recovery of cDNA to construct a cDNA library.

[0081] Primer design and PCR amplification: Design primers based on the 3' end of the giant anemone fluorescent protein analog gene (hmGFP) EST obtained from the random sequencing results of a small number of clones in the library and the n...

Embodiment 2

[0082] Example 2 Determination and analysis of the gene sequence of the giant sea anemone hmGFP fluorescent protein

[0083] The recovered electrophoresis products were connected to the T-easy vector, transformed into DH5α Escherichia coli, and the recombinant clones were selected for sequencing. A total of 18 clones were determined, and Blast homology analysis showed that 12 of them were hmGFP fluorescent protein gene sequences, and the length of these 12 hmGFP fluorescent protein genes was 904bp, encoding a hmGFP fluorescent protein protein with a length of 228 amino acids. The serial number is H175. Its amino acid sequence is not completely identical to jellyfish green fluorescent protein, its nucleotide sequence similarity is about 61%, and its protein sequence homology is only 50%. It is a new fluorescent protein gene.

[0084] Use the tool software DNAtools to analyze its base sequence and obtain its maximum reading frame. The start codon ATG appears near the 5' end, an...

Embodiment 3

[0108] Example 3 Construction of Recombinant Giant Anemone hmGFP Gene Expression Plasmid

[0109]A pair of primers were synthesized according to the two ends of the hmGFP gene of the giant anemone, and a Kpn I restriction site (GGTACC), ATG start codon and a Prescission ProtehmGe cutting site were introduced into the upstream primer, and BamH was introduced into the downstream primer. I restriction site (GGATCC) and stop codon TTA, TCA.

[0110] Upstream primer (P1): 5'-GG GGTACC CTGGAAGTTCTGTTCCAAGGTCCA ATG

[0111] Kpn I Prescission ProtehmGe cleavage site

[0112] TATTCTTACATCAAAG-3'

[0113] Downstream primer (P2): 5'-CG GGATCC TCA GGAAATGATCAT TTA CGAAC-3'

[0114] Bam H I

[0115] The pGEM-T easy plasmid containing the hmGFP gene of the giant sea anemone was used as a template, and P1 and P2 were used as primers for PCR amplification, and a specifically amplified single band was obtained, and ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
molecular weightaaaaaaaaaa
Login to View More

Abstract

The present invention discloses one new kind of actinia fluorescin gene, hmGFP, of length 904 bp, encoding 228 amino acid mature peptides and expressing protein with protein isoelectric point 7.89 and molecular weight 25,903 dalton. The also designs the cloning and expression of the new gene, constitutes karyogamy expression vector pTRX-hmGFP, prokaryotic non-fusion expression vector pET21b-hmGFP, eukaryotic expression vector pCDNA3-hmGFP. The expressed recombinant actinia fluorescin has fluorescent scattering wavelength 502 nm, maximum stimulating wavelength 490 nm and shoulder peak at 420 nm. Cloning hmGFP in prokaryotic expression vector pET21b and eukaryotic expression vector pCDNA3 realizes prokaryotic non-fusion expression and eukaryotic mammal cell expression, and the present invention may be used in intracellular positioning and functional research of gene encoding protein to be traced and marked.

Description

technical field [0001] The invention relates to a new gene, in particular to a new gene hmGFP of sea anemone fluorescent protein. The invention also relates to the cloning, expression and application of the new sea anemone fluorescent protein gene hmGFP. Background technique [0002] Green fluorescent protein (GFP) is a type of bioluminescent protein present in coelenterates including jellyfish, hydra, and corals. When excited by ultraviolet light or blue light, GFP emits green fluorescence. The GFP gene derived from jellyfish (Aequora victoria) is currently the most thoroughly researched and widely used fluorescent protein that has been cloned. As early as the early 1960s, Shimomura et al. first isolated a protein called aequoria from Aequoria victoria, which can emit blue light after binding calcium ions, and was called photoprotein at that time. In 1994, Chalfie expressed green fluorescent GFP in heterologous cells for the first time, which pioneered the application of ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C07K14/435G01N33/533
CPCG01N33/533C07K14/43595
Inventor 徐安龙涂洪斌熊茜
Owner SUN YAT SEN UNIV