Actinine fluorescent protein novel gene and its cloning, expression and use
A fluorescent protein and gene technology, applied in the field of new genes, can solve the problems of protein folding easily affected by temperature, lag, low gene expression, etc., and achieve the effect of high application prospect and industrial development value.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0079] Example 1 Extraction, library construction and PCR clone screening of the total RNA of the tentacle of the giant sea anemone
[0080] Extraction of total RNA and synthesis of cDNA: Dissect a giant sea anemone, collect 10 tentacles, use guanidine isothiocyanate method to extract total RNA from tentacles, and extract proteins with phenol / chloroform. Obtain 75 μg of total tentacles RNA, the A 260 / A 280 =1.9986, two clear bands of 28s and 18s can be seen by 1% formaldehyde denaturing gel electrophoresis, the ratio is >2, and mRNA smear, see figure 1 , indicating that the integrity of total RNA is good. Perform first-strand synthesis, LDPCR cDNA amplification, enzyme digestion and column recovery of cDNA to construct a cDNA library.
[0081] Primer design and PCR amplification: Design primers based on the 3' end of the giant anemone fluorescent protein analog gene (hmGFP) EST obtained from the random sequencing results of a small number of clones in the library and the n...
Embodiment 2
[0082] Example 2 Determination and analysis of the gene sequence of the giant sea anemone hmGFP fluorescent protein
[0083] The recovered electrophoresis products were connected to the T-easy vector, transformed into DH5α Escherichia coli, and the recombinant clones were selected for sequencing. A total of 18 clones were determined, and Blast homology analysis showed that 12 of them were hmGFP fluorescent protein gene sequences, and the length of these 12 hmGFP fluorescent protein genes was 904bp, encoding a hmGFP fluorescent protein protein with a length of 228 amino acids. The serial number is H175. Its amino acid sequence is not completely identical to jellyfish green fluorescent protein, its nucleotide sequence similarity is about 61%, and its protein sequence homology is only 50%. It is a new fluorescent protein gene.
[0084] Use the tool software DNAtools to analyze its base sequence and obtain its maximum reading frame. The start codon ATG appears near the 5' end, an...
Embodiment 3
[0108] Example 3 Construction of Recombinant Giant Anemone hmGFP Gene Expression Plasmid
[0109]A pair of primers were synthesized according to the two ends of the hmGFP gene of the giant anemone, and a Kpn I restriction site (GGTACC), ATG start codon and a Prescission ProtehmGe cutting site were introduced into the upstream primer, and BamH was introduced into the downstream primer. I restriction site (GGATCC) and stop codon TTA, TCA.
[0110] Upstream primer (P1): 5'-GG GGTACC CTGGAAGTTCTGTTCCAAGGTCCA ATG
[0111] Kpn I Prescission ProtehmGe cleavage site
[0112] TATTCTTACATCAAAG-3'
[0113] Downstream primer (P2): 5'-CG GGATCC TCA GGAAATGATCAT TTA CGAAC-3'
[0114] Bam H I
[0115] The pGEM-T easy plasmid containing the hmGFP gene of the giant sea anemone was used as a template, and P1 and P2 were used as primers for PCR amplification, and a specifically amplified single band was obtained, and ...
PUM
| Property | Measurement | Unit |
|---|---|---|
| molecular weight | aaaaa | aaaaa |
Abstract
Description
Claims
Application Information
Login to View More 