Human interferon analogue with long-lasting biological effects

A technology of interferon and human blood, applied in the field of long-acting human interferon analogs, can solve the problems of cytokine disappearance and interferon inactivation, and achieve the effect of easy transportation

Active Publication Date: 2005-02-23
FORTUNEROCK (CHINA) CO LTD ALL RIGHTS RESERVED +1
View PDF20 Cites 33 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0006] 2. Interferon
[0022] However, a general feature of these modes of use is the rapid inactivation of interferon-alpha present in various tissue fluids (O'Kelly et al., 1985. Proc. Soc. Exp. Biol. Med. 178, 407-411), resulting in Cytokines disappear from plasma within hours of injection (Rostaing et al., 1998, J.Am.Soc.Nephrol.9, 2344-2348)

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Human interferon analogue with long-lasting biological effects
  • Human interferon analogue with long-lasting biological effects
  • Human interferon analogue with long-lasting biological effects

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0092] Example 1 Brief description of molecular cloning technology

[0093] Conventional molecular cloning techniques include DNA and RNA extraction, agarose gel and polyacrylamide gel electrophoresis, DNA fragment ligation, and restriction enzyme digestion reactions. All refer to the literature (Maniatis et al., "Molecular Cloning Experiment Manual" Cold Spring Published by Port Laboratory, Cold Spring Harbor, New York, 1982). DNA polymerase chain reaction (PCR) (reference Saikiet et al., Science, 230:1350, 1985) used enzymes and PCR machines required for the reaction are all PerkinElmer products. And refer to the manufacturer's operating procedures. The oligonucleotide primers required for DNA sequencing and DNA amplification are completed by specialized agencies. Transgenic Escherichia coli was purchased from GIBCO / BRL. The purification of plasmid DNA and the recovery of DNA fragments are all prepared using commercial Qiagen purification columns. The yeast strains used in the p...

Embodiment 2

[0094] Example 2 Expression of Human Serum Albumin (HSA) Gene and Construction of Vector Plasmid

[0095] Using total RNA extracted from human fetal liver as a template, the HSA gene was synthesized and amplified by reverse transcription polymerase chain polymerization. 5 micrograms of total RNA are synthesized by reverse transcriptase (purchased from GIBCO / BRL company) to synthesize corresponding DNA strands. The oligonucleotide primers are 18 T+1N (N is random nucleotide). The reaction conditions were 45°C for 20 minutes, then the temperature was raised to 55°C, and the temperature was continued for 40 minutes.

[0096] The oligonucleotide primer sequence is:

[0097] Seq.ID NO.23: 5’- GAATTC ATGAAGTGGGTAACCTTTATTTCC-3’, and

[0098] Seq.ID NO.24: 5’- GAATTC TTATAAGCCTAAGGCAGCTTGACTT GC-3’

[0099] The oligonucleotide primers used to amplify HSA are designed according to the DNA sequence of V00494 in GenBank.

[0100] Two EcoRI recognition sites were added to both ends of the ...

Embodiment 3

[0104] Example 3. Molecular cloning of human interferon

[0105] 3.1. Molecular cloning of human interferon-α-1b

[0106] The molecular cloning of human interferon-α-1b was amplified from the total RNA preparation of human leukocytes (monocytes / macrophages / B lymphocytes) using the RT-PCR method similar to that described in Example 2. The oligonucleotide primers are:

[0107] SEQ ID NO. 25: 5'- CATATG TGTGATCTCCCTGAGACCC-3’

[0108] SEQ ID NO. 26: 5'- GGATCC TTACTTCCTCCTTAATCTTTC-3’

[0109] The polynucleotide has 579 base pairs, amplified by RT-PCR, and subcloned into Invitrogen's pCRIITA vector. DNA sequencing analysis confirmed the reading frame of human interferon-α-1b. The Nde I restriction enzyme site forms the 5'end, and the Bam HI restriction enzyme site forms the 3'end (the line part). The artificial start codon of interferon-α-1b is also included in this site (the line part of SEQ ID NO. 25). Figure 1 shows the DNA sequence (SEQ ID NO. 13) of human interferon α-1b and i...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to human interferon analogue with long-lasting biological effects and preparation method and medicinal effect thereof. The human interferon analogue is a syzygial albumin prepared by recombination of interferon and human serum albumin (HSA) in gene engineering method. Proved by animal experiment, the novel interferon has not only anti-virus effect of general interferon but also has prolonged half time as 3 to 10 times as other interferon, therefore, internal action time is prolonged. The long-lasting interferon can be used for treating virulence infection diseases, such as SARS, AIDS, hepatitis b, hepatitis c and hepatitis a, and can also be used for treating leukemia and chromoma. The storage period of the human interferon analogue is 3 to 5 times as the same of the traditional interferon.

Description

Technical field [0001] The invention relates to the production of human interferon analogues by using serum albumin recombination technology. Biological experiments have proved that this new type of interferon analog has the same biological activity in vivo and in vitro as interferon. Interferon analogs are yeast-expressed fusion proteins formed by albumin and interferon, which can be used to form long-acting recombinant protein drugs to improve the efficacy of recombinant protein drugs. Background technique [0002] 1. Albumin [0003] Human serum albumin (HSA) is a soluble monomeric protein that constitutes half of the total protein in the blood. As a basic carrier, albumin carries fatty acids, steroids and hormone molecules. Its stable inert nature is an important factor in maintaining blood pressure. Serum albumin is a spherical non-glycosylated serum protein with a molecular weight of 65 kilodaltons. The human serum albumin gene is located on chromosome 4 and has 16,961 base...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): A61P31/12C07K19/00C12N15/62C12N15/79
Inventor富岩于在林
OwnerFORTUNEROCK (CHINA) CO LTD ALL RIGHTS RESERVED