Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Fluorescent quantitative PCR method by using taqman probe for detecting salmonella in food

A Salmonella, fluorescence quantitative technology, used in biochemical equipment and methods, microbial determination/inspection, resistance to vector-borne diseases, etc., can solve the problems of unseen, minimum detection limit and quantification limit, etc. Short, specific effects

Inactive Publication Date: 2009-02-11
HUAZHONG AGRICULTURAL UNIVERSITY
View PDF0 Cites 8 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

These two articles did not detect fresh pork and fresh eggs artificially contaminated with Salmonella, and the minimum detection limit and quantification limit are relatively high
So far, there is no published invention patent similar to the present invention

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Fluorescent quantitative PCR method by using taqman probe for detecting salmonella in food
  • Fluorescent quantitative PCR method by using taqman probe for detecting salmonella in food
  • Fluorescent quantitative PCR method by using taqman probe for detecting salmonella in food

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0055] 1. Design and synthesis of primers and Taqman probes

[0056] The fimY gene sequences of Salmonella from various sources were obtained from GenBank, and the gene sequences were analyzed by Primer Express software. According to the design principles of primers and probes, a pair of 135bp-capable amplified target fragments was screened in the conserved regions of these sequences. Primers, and design a fluorescent probe in the amplification region of the primers. The fluorescent reporter group labeled at the 5' end of the probe is FAM, and the fluorescent quencher group labeled at the 3' end is TAMRA, which was synthesized by Shanghai Jikang Bioengineering Technology Service Co., Ltd.

[0057] The sequences of the primer pairs are

[0058] F1 (forward primer): GCGCTACCTGTCTCCTGTATTGA;

[0059] F2 (reverse primer): ACGCCCAGCCATACGGATA;

[0060] The probe sequence is

[0061] FP3AGCTACGCGCGCTCAGTTGGCA;

[0062] Wherein: the 5' end of the FP3 probe is marked with a FAM f...

Embodiment 2

[0071] 1. Quantitative PCR detection of food samples artificially inoculated with Salmonella

[0072] (1) Preparation of artificially inoculated samples

[0073] A. Sample treatment without shell eggs: Scrub the eggs with a hard brush under a stream of water. Soak clean eggs in 200ppm chloride ion solution containing 0.1% sodium dodecylsulfonate (SDS) for 30min. A 200 ppm cl- / 0.1% SDS solution was prepared by adding 8 mL of 5.25% sodium hypochlorite to 992 mL of distilled water containing 1 g of SDS. This disinfectant needs to be prepared extemporaneously before use. Aseptically open the eggs and homogenize. Aseptic operation Weigh 10 g of the homogenate into a sterilized 250 ml Erlenmeyer flask. Add 90ml of buffered peptone water and vortex to mix well.

[0074] Table 1 Stability detection of Salmonella detected by TaqMan PCR

[0075]

[0076] Table 2 Interday coefficient of variation of Salmonella detected by TaqMan PCR

[0077]

[0078] B. Whole egg sample ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to a fluorescence quantitative polymerase chain reaction (PCR) method with a Taqman probe for detecting salmonella in foodstuff. A primer, the Taqman probe and the fluorescence quantitative PCR are designed in allusion to fimY gene. Under optimal reaction procedures and reaction system, genomic DNA of a series of 10 times reference culture diluents of salmonella enteritidis extracted through poaching cracking process is taken as a template to carry through fluorescence quantitative PCR , and then specification curve is drawn. Based on linear relation R<2> and augmentation efficiency E, whether the repeated sample data are consistent and whether initial templates with different copy numbers have the same augmentation efficiency are judged. The method is used for detecting pork and egg specimens that are artificially polluted, and can check out the positive result under the inoculation concentration of 1-3cfu / 10g even though interfering germ with top concentration of 14.8*10<8>cfu / ml exists. The method uses specific primers with the fimY gene and the Taqman probe for detecting infected salmonella in foodstuff under optimal reaction conditions, and has higher stability, specificity and sensitivity; therefore, the method is a fast and exact salmonella detection method.

Description

technical field [0001] The invention relates to a rapid detection method for pathogenic bacteria in food, in particular to a method for detecting Salmonella in food by fluorescent quantitative PCR with a Taqman probe, which belongs to the field of food detection biotechnology and is suitable for quantitative detection of Salmonella in food. Background technique [0002] Salmonella is one of the zoonotic pathogens. It can not only cause animal diseases such as piglet paratyphoid fever and abortion, but also cause typhoid fever, paratyphoid fever, sepsis, gastroenteritis and food poisoning in humans. Patients with the disease manifest as diarrhea, fever, abdominal pain or Typical symptoms include convulsions, vomiting, headache and nausea, and even death. At present, governments all over the world have formulated very strict regulations on the limit standards of Salmonella in animal products, and the regulations on Salmonella in meat, eggs, and dairy livestock products are all...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12Q1/68C12Q1/10
CPCY02A50/30
Inventor 袁宗辉戴梦红王玉莲刘振利彭大鹏黄玲利王旭陈冬梅陶燕飞谢长清
Owner HUAZHONG AGRICULTURAL UNIVERSITY
Features
  • Generate Ideas
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com