Method for breeding high-yield glucoamylase industrial production strains

A technology of glucoamylase and bacterial strains, applied in the fields of genetic engineering and fermentation engineering, can solve problems such as low capacity and inability to meet the needs of industrial production

Inactive Publication Date: 2009-09-16
JIANGNAN UNIV
View PDF0 Cites 7 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0004] The ability of wild-type strains directly isolated from nature to accumulate products is often very low, which cannot meet the needs of industrial production, which requires us to carry out strain transformation on them, that is, breeding

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method for breeding high-yield glucoamylase industrial production strains
  • Method for breeding high-yield glucoamylase industrial production strains
  • Method for breeding high-yield glucoamylase industrial production strains

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0046] Example 1: pP glaA -Hyg R Construction of recombinant plasmids

[0047] PCR amplification was carried out using the chromosome of Aspergillus niger F0410 as a template, the upstream primer was GP1: GACCTTCCATGGAAGTGACCTGC′, and the downstream primer was GP2: G GCATGC CATGGCTGAGGTGTAATGATGCTGG (the underlined part is the NcoI restriction site) to obtain the DNA sequence containing the glucoamylase gene promoter.

[0048] The pBlueScript SK(-) vector was digested with SmaI, and reacted at 37°C overnight; the digested product and PCR product were recovered and purified, and then ligated under the action of T4 ligase for 14 hours to obtain the ligated product.

[0049] The ligation product was transformed into competent cells of the host strain E.coliJM109, positive clones were selected, and the successful construction of the recombinant plasmid pSK-P was confirmed by enzyme digestion and electrophoresis glaA .

[0050] Plasmid pSK-P was recovered using BamHI and NcoI ...

Embodiment 2

[0052] Example 2: Protoplast transformation of Aspergillus niger F0410

[0053] Preparation of protoplasts: Firstly, the Aspergillus niger strain was cultured on TZ medium at 34°C for 96 hours; standard colonies were selected and streaked on CD solid medium, and cultured at 34°C for 96 hours; 2 Put the left and right agar blocks into a 250mL Erlenmeyer flask containing 60mL CD solution, incubate at 34°C for 72-144h; collect the mycelium, wash once with 1mol / L sorbitol solution; ) into lysing enzyme solution, 30°C, 80r / min for enzymolysis; hemocytometer to monitor the number of protoplasts formed to determine the enzymolysis time; protoplast body fluid was filtered; the filtrate was centrifuged at 4°C, 3200r / min for 10min, and the supernatant was discarded; Wash the precipitate with pre-cooled 0.6mol / L KCl solution and STC solution, and centrifuge; resuspend the protoplast precipitate in an appropriate amount of STC solution, and put it in an ice bath for later use.

[0054] P...

Embodiment 3

[0055] Example 3: Ion beam mutagenesis of transformant CICIM GAH14 and breeding of high-yield strains

[0056] Take the CICIM GAH14 mycelium suspension dispersed by glass beads, centrifuge at room temperature, 8000r / min×10min to collect the bacteria, filter through a single layer of clean paper and use 0.5mL10% glycerol to make 10 8 1 / mL mycelial suspension, spread 0.3-0.5mL mycelial suspension evenly in a sterile plate, dry it in a sterile state to form a layer of bacterial film, and use a nitrogen ion beam with an energy of 10KeV , with a dose of 60×2.6×10 13 N + / cm 2Pulse injection was carried out under the conditions, and then the treated bacterial film was washed with 1 mL of sterile water, diluted four times, spread on TZ culture plates containing 1200 μg / mL hygromycin and hygromycin-free, and cultured at 34 °C 48~60h. On the hygromycin-resistant plate, a total of 80 colonies (big colony diameter and vigorous growth) grown simultaneously with the hygromycin-free TZ ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

A method for breeding high-yield glucoamylase industrial production strains belongs to the field of genetic engineering and fermentation engineering. The method comprises the following steps of: firstly, constructing a recombinant plasmid pPglaA-Hyg<R> expressed by a glucoamylase gene promoter-regulated hygromycin resistance gene; secondly, after subjecting the recombinant plasmid pPglaA-Hyg<R> to the linearization of the Hind III, transforming the protoplast of aspergillus niger F0410 to integrate the glucoamylase gene promoter-regulated hygromycin resistance gene into the genome of the aspergillus niger randomly; thirdly, screening out a transformant by using hygromycin B to obtain hygromycin-resistance recombinant aspergillus niger engineering bacteria named CICIM GAH14; and finally, carrying the physical mutagenesis of the CICIM GAH14 by using a conventional mutagenesis technique, and screening mutant strains by using hygromycin B at a higher concentration to obtain the high-yield glucoamylase industrial production strains. In the obtained high-resistance strains, positive mutation rate reaches 37.5 percent, and the glucoamylase production level of the positively mutant strains is improved 8 to 58.7 percent compared with the original aspergillus niger strain.

Description

technical field [0001] The invention relates to a method for improving the enzyme-producing activity of glucoamylase industrial production strains through genetic engineering technology and mutation breeding technology, belonging to the fields of genetic engineering and fermentation engineering. Background technique [0002] Glucoamylase, full name glucoamylase (1,4-α-glucan hydrolase, EC.3.2.1.3), is an extracellular enzyme secreted by a series of microorganisms with exonuclease activity. It can hydrolyze α-1,4 glucosidic bonds from non-reducing ends of carbohydrates such as starch, dextrin or glycogen to release β-D-glucose, and also slowly hydrolyze α-1,6 glucosidic bonds and α-1 , 3 glycosidic bonds release glucose. Glucoamylase is the main enzyme used in starch saccharification and fermentation to produce alcohol and glucose syrup. Therefore, it is widely used in food, medicine, fermentation and other industries. It has high commercial value and is one of the largest e...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/80C12N15/01C12R1/685C12R1/69C12R1/845
Inventor王正祥石贵阳
OwnerJIANGNAN UNIV