Unlock instant, AI-driven research and patent intelligence for your innovation.

Bacillus amyloliquefaciens LC02 and application thereof

A technology of amylolytic spores and spore laccase, which is applied in the field of applied microorganisms, can solve the problem of less bacterial laccase, and achieve good thermal stability

Inactive Publication Date: 2011-07-06
NORTHEAST FORESTRY UNIVERSITY
View PDF3 Cites 9 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

There have been many studies on the application of laccases derived from white rot fungi or other fungi to decolorize dyes, but there are few reports on bacterial laccases and bacterial laccase-mediator systems in dye decolorization

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Bacillus amyloliquefaciens LC02 and application thereof
  • Bacillus amyloliquefaciens LC02 and application thereof
  • Bacillus amyloliquefaciens LC02 and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0048] The property of embodiment 1 bacillus amyloliquefaciens LC02 spore laccase

[0049] 1. Effect of pH value on activity and stability of spore laccase

[0050] The effect of pH on laccase activity using pH2.2-7.8 citric acid-phosphate buffer (0.1mol / L), pH7.4-9.0Tris-HCl (0.05mol / L) buffer and pH8.6-10.0 glycine -Sodium hydroxide buffer solution (0.05mol / L) is measured, and the influence of pH on the stability of laccase is by the citric acid-phosphate buffer solution of pH3.0,8.0, the Tris of pH9.0 by laccase at 30 ℃ -HCl buffer solution and pH 10.0 glycine-sodium hydroxide buffer solution were mixed and placed for 1-10 days to determine the remaining activity. Figure 1-3 It shows that the spore laccase provided by the invention has a wide range of catalysis, and can catalyze the substrate reaction in the scope of pH2.2-10.0. When using ABTS, syringaldazine and 2,6-dimethoxyphenol as substrates The measured pH optimums were 4.0, 6.6 and 7.6, respectively. Figure 4 T...

Embodiment 2

[0057] Example 2 Bacillus amyloliquefaciens LC02 spore laccase to the decolorization of synthetic dyes

[0058] 1. The reaction system of the decolorization experiment and the calculation of the decolorization rate

[0059] The experimental reaction system was 6ml, and pH 6.6 citric acid-phosphate buffer (0.1mol / L), dyestuff (see Table 1 for the species and final concentration), and Bacillus amyloliquefaciens LC02 spore laccase (final concentration of 1mg / ml) and acetosyringone (final concentration 0.1mmol / L). At the same time, the reaction system without adding Bacillus amyloliquefaciens LC02 spore laccase was used as a blank control. Samples were taken regularly, centrifuged at 12000 rpm for 2 minutes, and the absorbance values ​​at the maximum absorption wavelengths (see Table 1) of each dye were measured. All measurements were repeated three times to obtain the average value. Then calculate the dye decolorization rate. The formula for calculating the decolorization rat...

Embodiment 3

[0065] Cloning of embodiment 3 Bacillus amyloliquefaciens LC02 spore laccase gene

[0066] 1. Cloning of strain laccase gene

[0067] Pick the above strains into 5mL LB liquid medium, culture overnight at 37°C, 200rpm. Genomic DNA of the above strains was extracted according to the instructions of the bacterial genome extraction kit from Omega Company, and detected by 1% agarose gel electrophoresis.

[0068] Genomic DNA was used as a template, and the upstream primer "CGG GAATTC GGCACTGGAAAAATTTGCAGATG" (restriction site EcoR I) and downstream primer "CCG CTCGAG TTACTGCTTATCCGTGACGTCC" (restriction site Xho I) amplifies the spore laccase gene of Bacillus amyloliquefaciens LC02.

[0069] Add the following reagents to a 200 μL PCR tube: ddH 2 O 13.75 μL, 10×Ex Taq Buffer 2 μL, 10 mmol / L dNTP mixture 1 μL, 10 μmol / L upstream primer 1 μL, 10 μmol / L downstream primer 1 μL, DNA template 1 μL, Ex Taq enzyme 0.25 μL, total volume 20 μL. A negative control was also set up. PCR ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
temperatureaaaaaaaaaa
Login to View More

Abstract

The invention discloses a preparation method of bacillus amyloliquefaciens LC02 (CGMCC No.4258) spore laccase, the catalysis capability and the application in the decoloring the dye. The invention further relates to a nucleotide sequence which codes the spore laccase. The bacillus amyloliquefaciens LC02 is fermented on a solid state spore generating culture medium at 37 DEG C for 5 days, and the spore is washed by the deionized water to obtain the spore suspension liquid with the laccase activity by a series of measures such as the lysozyme. The spore laccase is better in catalytic activity under the alkaline and high-temperature conditions, is better in a decoloring effect to the synthetic dyes with different structures under the action of a medium, and is used for treating the industrial dye waste water.

Description

technical field [0001] The invention relates to a bacterial laccase, in particular to a preparation method and catalytic properties of a spore laccase of Bacillus amyloliquefaciens LC02, and a nucleic acid fragment encoding the spore laccase. In addition, the invention also relates to a method for decolorizing synthetic dyes by the spore laccase, which belongs to the field of applied microorganisms. Background technique [0002] Laccase (EC 1.10.3.2) is a copper-containing polyphenol oxidase, which can catalyze the oxidation of aromatic compounds of various structures by using copper ions in the active center, and simultaneously reduce molecular oxygen to water. Due to the wide range of substrates catalyzed by laccases, laccases have been widely used in the paper industry, textile industry, food industry, and soil bioremediation. [0003] Laccase-catalyzed oxidation of substrates generally includes two modes of action. The first is that substrate molecules directly react wi...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N1/20C12N9/02C12N15/53C12R1/07
Inventor 赵敏卢磊潘俊波李德斌王天女李明洋栗君
Owner NORTHEAST FORESTRY UNIVERSITY
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More