A Method for Parallel Assembly of Multiple Segments of DNA

A DNA sequence and fragment technology, applied in the field of genetic engineering, can solve the problems of low recombination efficiency, difficult in vitro operation of long DNA fragments, and difficulty in parallel operation, etc.

Inactive Publication Date: 2011-12-28
石振宇
View PDF6 Cites 6 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Long fragments of DNA often contain multiple restriction endonuclease sites and are difficult to manipulate
[0006] 2. Restriction endonuclease sites need to be operated in vitro, and long fragments of DNA are difficult to operate in vitro
[0007] 3. When it is necessary to avoid restriction enzyme cutting sites, it is difficult to parallelize the operation
Disadvantages of this method: 1. The cost of synthetic DNA is relatively high
2. It cannot avoid the problem that large fragments of DNA are difficult to operate in vitro
Disadvantages of this method: 1. The problem of containing this type of restriction site in the natural sequence cannot be avoided
2. The number of fragments assembled at one time should generally not exceed 10, otherwise the connection efficiency is very low
3. It is difficult to operate in vitro for large fragments
Disadvantages of this method: 1. Due to the complete use of homologous recombination, erroneous recombination will occur when there are repeated sequences in the reassembled fragments
2. The reorganization efficiency of this method is not high, and few people actually use it
Disadvantages of this method: 1. It is a sequential assembly system and cannot be parallelized
Disadvantages of this method: 1. Because it involves the PCR process, it is easy to introduce mutations
2. Not suitable for assembling long fragments
Disadvantages of this method: 1. Due to the increase in the length required for recombination, for natural fragments, it is difficult to obtain recombined fragments of more than 80 bases in one PCR, so this method is mainly used for full chemical synthesis of genomes
However, the cost of fully chemically synthesized genomes is too high, resulting in a very limited range of applications
2. During the assembly process, it is necessary to use a vector with a higher copy number for intermediate cloning. It is not suitable to assemble fragments exceeding 50Kbp in E. coli

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • A Method for Parallel Assembly of Multiple Segments of DNA
  • A Method for Parallel Assembly of Multiple Segments of DNA
  • A Method for Parallel Assembly of Multiple Segments of DNA

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0343] Example 1: Assemble luxA, luxB, luxC, luxD, luxE using a circular assembly system.

[0344] Original plasmid: pAH57, expressing Lambda Int Xis. pAH69, expresses HK022 Int. pAH129, expresses Phi80 Int Xis. pAH83 expresses HK022 Int Xis. pAH70, containing HK022 attP. Retrieved from CGSC (http: / / cgsc.biology.yale.edu / ). pCMR expresses HK022-Lambda Chemira Int Xis. pAH69Pir, expresses HK022 Int and Pir genes. pCMRPir expresses HK022-Lambda Chemira Int Xis and Pir genes. pAH129E, obtained by destroying lambda C1 in pAH129 with HindIII.

[0345] Construct the plasmid:

[0346] (1) Construction of auxiliary plasmids:

[0347] Synthetic primers:

[0348] EVF: ACCTGACCGCTATCCCTGA

[0349] EVR: GCCCTTCAATCGCCAGA

[0350] IHF: TTGACTATTTTACCCTCTGGCGG

[0351] IHR:TCCGACTTATGCCCGAGAAGACGTTG

[0352] IIF: CAACGTCTTCTCGGGCATAAGTCGGA

[0353] IIR: AATAACATGTAGCTTGGCATTGCTTATCAA

[0354] Synthetic gene:

[0355] p1pir:ACTAGTTTGAATTGGTCACGACTTTGCGAAGCAAAGTCTAGTGAGTATACT...

Embodiment 2

[0490] Embodiment 2: luxA, luxB, luxC, luxD, luxE are assembled using a linear assembly system.

[0491] (1) Build pLUHelp:

[0492] Gene synthesis:

[0493] CrossInt:[AY048721.1:878-1258][AY048721.1:1259-1602][AY048715.1:1614-2236]TTGGCACTGGCTGATCAGCTAGCACATGT

[0494] Experimental steps:

[0495] Construction of pLUHelpH: digest pAH83 with restriction endonucleases NcoI and EcoRI, separate the 3822bp fragment in the digested product by agarose gel electrophoresis, treat the separated product with alkaline phosphatase, and label the product as cAH83. CrossInt was digested with restriction endonucleases EcoRI and PciI, and a 1375bp fragment in the digested product was separated by agarose gel electrophoresis, labeled as cCrossInt. Ligate cCrossInt and cAH83 with T4 DNA ligase, electrotransform the ligated product into a competent E. coli DH5α, spread the transformed product on an LB agar plate containing ampicillin, and incubate at 30°C until visible For single clones, pick ...

Embodiment 3

[0582] Example 3: Assembly of the lux gene in a circular host-free recycling system.

[0583] (1) Build pUC-Gate:

[0584] Synthetic primers:

[0585] PG1:CGTTCGCAGAATTGGGAATC

[0586] PG2: GGGATAGCAAGCCCAATAGG

[0587] M13F:TGTAAAACGACGGCCAGT

[0588] M13R: CAGGAAACAGCTATGACC

[0589] Synthetic Gene:

[0590] Gate(克隆在pQLV中):AAGCTTGCGGCCGCGAAGTTCCTATTCCGAAGTTCCTATTCTCTAGAAAGTATAGGAACTTCTTAATTAACCAGCCTCGCAGAGCAGGATTCCCGTTGAGCACCGCCAGGTGCGAATAAGGGACAGTGAAGAAGGAACACCCGCTCGCGGGTGGGCCTACTTCACCTATCGGTACCTTCGAGAGCTCCACCGAGTGACTAGTATGATGAATTCCACACGGTGGTCGACTACGTGCTAGCCTCGAGCAATTG

[0591] Experimental procedure: PCR was performed on Gate with GP1 and PG2, and the obtained fragment was digested in Fermentas T Buffer with MfeI and HindIII. Enzyme digestion product solution recovery. Labeled fragment cGate. The pUC18 vector was digested with EcoRI and HindIII in Fermentas R Buffer, and FastAP was added for dephosphorylation. Enzyme digestion product solution recovery. Labeled a...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to a method for parallel assembly of multi-segment DNA. Choose to insert the circular or linear unit vector into the circular host or linear host to form a gene carrier, and then recover the circular or linear vector to obtain the recombined DNA genetic material. Its characteristic is that it can realize parallel and simultaneous operation of multiple pieces of DNA, thereby improving the efficiency of DNA assembly to form a new DNA structure, and preventing DNA pollution and disproportionation, ensuring the quality of assembled DNA, so that it can achieve the design purpose. The time required to assemble multiple pieces of DNA is approximately proportional to log(N). The assembly operation is carried out outside or inside the cell, so that multiple DNA molecules can be spliced ​​in any order to form a new DNA structure. It is suitable for application in the field of genetic engineering to obtain new organisms through genetic recombination.

Description

technical field [0001] The invention relates to gene recombination technology in the field of genetic engineering, in particular to a method for parallel assembly of multiple segments of DNA. Background technique [0002] All the forms of life that humans have come into contact with at present require a complete cell structure to exert all the characteristics of an organism. In cells, DNA is the main genetic material, DNA is transcribed to form RNA, RNA is translated to produce protein, and RNA and protein realize biological functions in biological cells. Therefore, the most essential modification of organisms is the modification of DNA. The ability to transform DNA determines the ability of human beings to transform and even create creatures. [0003] After 2005, technologies related to synthetic biology need to develop appropriate large-scale gene assembly technology to meet the development and needs of genetic engineering and metabolic engineering. [0004] "Recombina...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C12N15/09C12N15/64C12N15/66C12N15/70C12R1/19
Inventor石振宇
Owner石振宇