Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Haynaldia villosa metal transport protein gene, protein coded by haynaldia villosa metal transport protein gene and application of haynaldia villosa metal transport protein gene

A metal transporter, tufted wheat technology, applied in the field of genetic engineering, can solve the problems of increasing manpower, material resources, environmental pollution, etc.

Active Publication Date: 2013-04-03
NANJING AGRICULTURAL UNIVERSITY
View PDF1 Cites 4 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0003] Although powdery mildew can be controlled by fungicides, it will inevitably increase the input of manpower and material resources, and it will also cause ecological problems such as environmental pollution. Therefore, cultivating and promoting disease-resistant varieties has been recognized as the most economical, safe and effective way to control wheat powdery mildew. The study of disease-resistant genetic background and disease-resistant mechanism is an important basis for formulating disease-resistant breeding strategies

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Haynaldia villosa metal transport protein gene, protein coded by haynaldia villosa metal transport protein gene and application of haynaldia villosa metal transport protein gene
  • Haynaldia villosa metal transport protein gene, protein coded by haynaldia villosa metal transport protein gene and application of haynaldia villosa metal transport protein gene
  • Haynaldia villosa metal transport protein gene, protein coded by haynaldia villosa metal transport protein gene and application of haynaldia villosa metal transport protein gene

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0026] Example 1 Cloning of metal transporter gene HvFP3 by yeast two-hybrid

[0027] Diploid pilosetris (references: Qi Lili, Chen Peidu, et al., New source of resistance to wheat powdery mildew—gene Pm21, Acta Crops Sinica, 1995, 21(3):257-262) is a material highly resistant to powdery mildew. Hv-CMPG is a powdery mildew resistance-related gene located on diploid P. villosa 6V cloned by the Institute of Cytogenetics, Nanjing Agricultural University (Liu Yuan. Cloning of Hv-CMPG gene in P. villosa and preliminary analysis of its function[D] .Nanjing.Nanjing Agricultural University, 2007), with Hv-CMPG as bait, use polyethylene glycol-lithium acetate transformation method to screen yeast two-hybrid cDNA library, get a Hv-CMPG interaction gene (attached figure 1 ). The interaction gene was sequenced, and a sequence with a size of 702bp was obtained, as shown in SEQ ID NO.1. Search the open reading frame of the obtained sequence through ORFfinder on the NCBI website, and find ...

Embodiment 2

[0028] Embodiment 2Hv-FP3 gene is subjected to the expression characteristic that powdery mildew induces

[0029] The powdery mildew-resistant wheat seeds (references: Qi Lili, Chen Peidu, etc., new resistance source of wheat powdery mildew-gene Pm21, Acta Biological Sciences, 1995, 21(3):257-262) were sown in a petri dish to germinate , and transplanted to pots after dew whitening (isolated with a cylindrical transparent plastic sheet around, and closed with filter paper at the top to form an environment free of powdery mildew). At the three-leaf stage, shake off the fresh spores of Nanjing local mixed powdery mildew cultured on the susceptible variety Sumai No. 3 on the seedlings of A. The leaves of T. villosa inoculated with powdery mildew were stored at 16°C. Samples were taken at 0h, 45min, 1h, 2h, 4h, 6h, 12h, 24h, 48h, and 72h after inoculation, and stored in a -70°C refrigerator for later use. TRIZOL (Invitrogen) was used to extract RNA from the leaves of A. villosa ...

Embodiment 3

[0031] Example 3 Construction of Hv-FP3 Sense Expression Vector and Its Transformation Common Wheat Yangmai 158

[0032]Using the above-mentioned C. villosa cDNA induced by powdery mildew as a template, the primer pair P3 (CGGGATCCATGGGCGCCTTGGATCACCT (SEQ ID NO.5)) and P4 (GGGGTACCTCACATGACGGTGCAGGCGT (SEQ ID NO.6) that can amplify the protein coding region of the Hv-FP3 gene )) Perform PCR amplification, and recover the amplified fragment. Insert the amplified target fragment into the vector pBI220 (Jefferson RA, Kavanagh TA, Bevan MW. GUS fusions: beta-glucuronidase as a sensitive and versatile gene fusion marker inhigherplants.EMBO J.1987,6:3901) with BamHI and KpnI double digestion -3907.) between the multiple cloning site BamHI and KpnI behind the 35s promoter. Thus, the target gene Hv-FP3 was cloned to the downstream of the strong promoter 35s to obtain the expression vector pBI220:FP3 (attached image 3 ).

[0033] The constructed overexpression vector was transform...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a haynaldia villosa metal transport protein gene, protein coded by the haynaldia villosa metal transport protein gene and an application of the haynaldia villosa metal transport protein gene, and belongs to the field of gene engineerings. A cDNA (complementary DNA) sequence of Hv-FP3 is SEQ ID NO. 1 and an amino acid sequence coded by the Hv-FP3 is SEQ ID NO. 2. The gene comes from diploid haynaldia villosa (Haynaldia villosa, VV, 2n-14), and expression of the gene is enhanced because the gene is induced by powdery mildew in powdery mildew resistance diploid haynaldia villosa. The Hv-FP3 gene is transformed to be a susceptible powdery mildew wheat variety Yangmai 158, a transgenic T0 generation plant is subjected to powdery mildew resistance identification, and the result shows that over-expression of the Hv-FP3 gene can improve resistance of the Yangmai 158 to the powdery mildew. The Hv-FP3 is possibly applied to gene engineering breeding; and the Hv-FP3 is induced into the susceptible powdery mildew wheat variety, and the powdery mildew resistance of the wheat is possibly improved.

Description

technical field [0001] The invention belongs to the field of genetic engineering, and discloses a metal transporter gene of tufting wheat and its coded protein and application. Background technique [0002] Wheat powdery mildew caused by the obligate parasitic fungus Blumeria graminis DC f.sp.tritici is one of the increasingly serious diseases in wheat production in China and many countries in the world. Plants can be infected by powdery mildew from the one-leaf stage to senescence. Early infection reduces tillers, and late infection of upper leaves and ears severely reduces grain yield (20%-33%). [0003] Although powdery mildew can be controlled by fungicides, it will inevitably increase the input of manpower and material resources, and it will also cause ecological problems such as environmental pollution. Therefore, cultivating and promoting disease-resistant varieties has been recognized as the most economical, safe and effective way to control wheat powdery mildew. T...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/29C12N15/63C07K14/415A01H5/00
Inventor 李颖波王秀娥曹爱忠王海燕邢莉萍肖进费菲祝燕飞
Owner NANJING AGRICULTURAL UNIVERSITY
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com