Unlock instant, AI-driven research and patent intelligence for your innovation.

Lyase for killing staphylococcus and application of lyase

A technology of staphylococcus enzyme and staphylococcus, which is applied in the application field of Aspects and can solve the problems of insoluble expression, narrow pH range of action, low activity and the like

Active Publication Date: 2013-05-29
WUHAN INST OF VIROLOGY CHINESE ACADEMY OF SCI
View PDF2 Cites 17 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, most of these lyases are difficult to express in soluble form, or their activity is not high, and their action pH range is narrow, generally at pH 5-8

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Lyase for killing staphylococcus and application of lyase
  • Lyase for killing staphylococcus and application of lyase
  • Lyase for killing staphylococcus and application of lyase

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0034] Example 1. Construction and expression of a lyase capable of killing Staphylococcus.

[0035] Take an approach that includes the following steps:

[0036] 1. After bioinformatics analysis of the characteristics of the catalytic domain and cell wall binding domain of various staphylococcal lyases, a gene sequence encoding a new lyase was artificially designed in the laboratory. For the convenience of description, we name the gene as ClyH , named the enzyme encoded by the gene as ClyH. ClyH The nucleic acid sequence is as follows:

[0037] atggcactgcctaaaacgggtaaaccaacggcaaaacaggtggttgactgggcaatcaatttaatcggcagtggtgtcgatgttgatggttattatggtcggcaatgttgggatttacctaactatatttttaatagatactggaactttaagacaccaggcaacgcaagagatatggcatggtatagatatcctgaagggtttaaagtgtttagaaacacttctgattttgtccctaaaccaggtgatatagcagtgtggacaggtggtaattacaattggaacacttggggacacactggtattgttgtaggtccatcaactaaaagttacttttatagtgtagatcagaattggaataactctaactcttacgttggtagtcctgcagcaaagataaaacatagttattttggtgtaactcattttgttagaccc...

Embodiment 2

[0052] Example 2. The activity and action site of ClyH killing Staphylococcus aureus standard strain CCTCC AB91118.

[0053] Take 10 ml of the overnight culture of Staphylococcus aureus, collect it by centrifugation, wash once with phosphate buffered saline (PBS), and resuspend in 1 ml of PBS solution. Take 2 μg of ClyH and mix it with the above bacteria solution (before mixing, adjust the concentration of the bacteria solution with PBS buffer so that the absorption value at 600 nm is close to 1.0 after mixing with the same amount of ClyH solution in PBS buffer), and monitor the mixing with a microplate reader The change in the absorbance of the solution at 600 nm. At the same time, a mixture of PBS buffer and Staphylococcus aureus was used as a control. The final cracking curve obtained is shown in figure 2 . The results show that ClyH can rapidly lyse the CCTCC AB91118 strain, resulting in a decrease in the turbidity of the bacterial solution, which is manifested by a ra...

Embodiment 3

[0054] Example 3. Verification of ClyH killing Staphylococcus epidermidis and methicillin-sensitive Staphylococcus aureus (MSSA) in vitro and its specificity to different strains.

[0055] In order to verify the bactericidal spectrum of ClyH, we selected several non-staphylococcal strains (see Figure 4 Bacterial names marked on the abscissa) and clinically isolated Staphylococcus epidermidis (strain numbers: B51, B311, B511, B530, C208, D417, D970, ATCC12228), and methicillin-sensitive Staphylococcus aureus (MSSA) strains ( Strain numbers: AB918, B30, D390, D403, D405, JM113, JM114) were tested together. Firstly, the tested strains were cultured overnight, and 10 ml of the culture was collected by centrifugation, washed once with PBS, and then resuspended in 1 ml of PBS buffer. Take 2 μg of ClyH and the above bacterial solution (before mixing, adjust the concentration of the bacterial solution with PBS buffer, so that it is mixed with the same amount of PBS buffer as the Cly...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a lyase for killing staphylococcus and an application of the lyase and also discloses an amino acid sequence and an encoding gene sequence of the lyase. A recombined lyase constructed by using the disclosed encoding gene can realize soluble expression in Escherichia coli BL21 (DE3); the lyase can be used for efficiently killing various types of staphylococcus including clinically-separated methicillin-sensitive staphylococcus aureus (MSSA) and methicillin-resistant staphylococcus aureus (MRSA) in vitro and can also be used as an antibiotic for treating staphylococcus infection in vivo; and the disclosed lyase can also be used for rapidly cracking the cell wall of the staphylococcus and releasing substances in cells, such as adenosine triphosphate (ATP), DNA (Deoxyribonucleic Acid) and the like, and various detections on the staphylococcus can be realized through detecting released substances.

Description

technical field [0001] The present invention relates to the field of biological preparations, in particular to a lyase and coding gene capable of killing Staphylococcus, especially Staphylococcus aureus, as well as an antibiotic for killing Staphylococcus in vitro, treating Staphylococcus infection in vivo, and a Staphylococcus detection and other applications. technical background [0002] Staphylococcus can be divided into three types according to biochemical reactions and pigment production: Staphylococcus aureus, Staphylococcus epidermidis and Staphylococcus saprophytics. Among them, Staphylococcus aureus is mostly pathogenic bacteria, Staphylococcus epidermidis is occasionally pathogenic, and Staphylococcus saprophyticus is generally not pathogenic. Staphylococcus aureus (staphylococcus aureus) is a common Gram-positive coccus that can cause many serious infections in humans and animals, and is also one of the common pathogens of hospital infections (Brumfitt, W. and J...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N9/88C12N15/60A01N63/00A01P1/00A61K38/51A61P31/04C12Q1/68C12Q1/66C12Q1/527C12Q1/14C12R1/445
Inventor 危宏平杨航张云余军平张先恩
Owner WUHAN INST OF VIROLOGY CHINESE ACADEMY OF SCI
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More