Method for preparing R-o-chloromandelic acid methyl ester through biocatalysis dynamic kinetic resolution

A technology of methyl mandelate and dynamic kinetics, applied in biochemical equipment and methods, methods based on microorganisms, microorganisms, etc., can solve problems such as lack of, and inability to achieve ideal yields, and achieve simple operation, low production cost, The effect of high catalytic efficiency

Active Publication Date: 2014-05-28
ZHEJIANG UNIV +1
View PDF2 Cites 3 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0008] The present invention aims at the shortcoming that the method for obtaining R-o-chloromandelic acid methyl ester by reducing methyl o-chlorobenzoylformate in the prior art cannot reach the ideal yield in the absence of coenzyme, and provides a method without coenzyme The method for preparing R-o-chloromandelic acid methyl ester can be realized

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method for preparing R-o-chloromandelic acid methyl ester through biocatalysis dynamic kinetic resolution
  • Method for preparing R-o-chloromandelic acid methyl ester through biocatalysis dynamic kinetic resolution
  • Method for preparing R-o-chloromandelic acid methyl ester through biocatalysis dynamic kinetic resolution

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0035] Embodiment 1, to the cloning of mandelate racemase gene

[0036] According to the mandelic acid racemase gene sequence (mdla) of Pseudomonas putida in NCBI, the upstream and downstream amplification primers and enzyme cutting sites EcoR I / Xho I were designed (the parts in italics are the enzyme cutting sites and corresponding protection base). Primers were designed as follows:

[0037] Primer 1: GGAATTC ATGAGTGAAGTACTGATTACCG

[0038] Primer 2: CCGCTCGAGTTTACACCAGATATTTCCCGATTT

[0039] PCR amplification was performed using the genomic DNA of Pseudomonas putida (ATCC12633, purchased from the American Type Culture Collection) as a template. The PCR system is 10×DNA polymerase buffer5μL, MgCl 2 (25mmol / L) 4μL, dNTPs (10mmol / L) 1μL, primer 1 (10μmol / L) 1μL, primer 2 (10μmol / L) 1μ, genome template: about 10ng, Taq DNA polymerase (5U / μL) 0.5μL, ddH 2 O (i.e. redistilled water) to a total volume of 50 μl.

[0040] The PCR amplification steps are: (1) pre-denaturation a...

Embodiment 2

[0041] Embodiment 2, preparation of recombinant plasmid pET30a-MR

[0042] The mandelic acid racemase gene target band recovered in Example 1 was double-digested with restriction endonuclease EcoR I / Xho I for 12 h at 37°C, purified by agarose gel electrophoresis, and purified using agarose gel DNA The recovery kit recovers the target band. Under the action of T4 DNA ligase, the target fragment was ligated with the plasmid pET30a that had also been digested with EcoR I / Xho I, and the recombinant plasmid pET30a-MR was obtained overnight at 4°C.

Embodiment 3

[0043] Embodiment 3, the construction of recombinant MR mutant strain

[0044] Using the recombinant MR obtained in Example 2 as a template, use the QuickChange method to perform site-directed mutagenesis at the 22 or 26 position. The PCR amplification steps are: (1) pre-denaturation at 98°C for 1 min, (2) at 98°C Under the condition of ℃, denature for 30s, (3) anneal at 56℃ for 90s, (4) extend at 72℃ for 7min; repeat steps (2)-(4) 20 times, (5) extend at 72℃ for 5min, cool to 4℃. The obtained PCR product was cleaned and digested with Dpn I to eliminate the methylated template, and then retransformed into E.coli BL21 (DE3) competent cells, and spread onto LB plates containing kanamycin. Cultured upside down at 37°C overnight, single clones were picked and sequenced for verification, and recombinant MR mutants were obtained.

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to the field of biological engineering and discloses a method for preparing R-o-chloromandelic acid methyl ester through biocatalysis dynamic kinetic resolution. Under a condition that pH is 7-8, recombined racemase and recombined esterase are linked or gene engineering bacteria capable of respectively expressing the recombined racemase and the recombined esterase are linked to implement conversion by taking racemized o-chloromandelic acid methyl ester as a substrate; the recombined racemase is recombined mandelic acid racemase, and the recombined esterase is recombined BioH esterase. The method disclosed by the invention has the advantages that the recombined racemase and the recombined esterase are linked or the gene engineering bacteria containing the recombined racemase and the recombined esterase are linked, so that the aim of preparation is fulfilled; the technology is simple; the conversion efficiency is high; the problem of instability caused by a double-enzyme system is solved; the method has higher application value.

Description

technical field [0001] The invention relates to a bioengineering technology for preparing R-o-chloromandelic acid methyl ester, in particular to a method for preparing R-o-chloromandelic acid methyl ester through biocatalytic dynamic kinetic resolution. Background technique [0002] Clopidogrel (Clopidogrel), chemical name S-α-(2-chlorophenyl)-6,7-dichlorothieno[3,2-c]pyridine-5(4H)-acetic acid methyl ester, a platelet The coagulation inhibitor was successfully researched and developed by the French company Sanofi-Aventis in 1986. Its sulfate salt, trade name Plavix (Plavix), is mainly used for the treatment of cardiovascular and cerebrovascular diseases such as atherosclerosis. In 2009, the global sales of this drug reached 10 billion US dollars, second only to the blood lipid-lowering drug atorvastatin, and it is called the second best-selling drug in the global drug market. R-methyl o-chloromandelate is an important chiral substance for the synthesis of clopidogrel. The ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C12P41/00C12P7/62C12N15/70C12N1/21C12R1/19
Inventor于洪巍顾佳黎胡建波
OwnerZHEJIANG UNIV