Oleaginous yeast fatty acid synthase, and coding gene and application thereof
A technology of fatty acid synthase and oleaginous yeast, applied in application, genetic engineering, plant gene improvement, etc., can solve problems such as increasing the oil content of recombinant strains
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0099] Example 1: Discovery of Rhodotorula graminearum fatty acid synthase
[0100] R. graminis ATCC MYA-4893 was revived on YEPD solid medium, cultured upside down at 30°C for 48 hours, picked a single colony and inoculated in 50ml YEPD liquid medium (filled in a 250ml Erlenmeyer flask), and cultured at 30°C, 200rpm for 28h. The culture medium was transferred to a 2L continuous fermenter (working volume 1.7L) with automatic feeding at a ratio of 1:50 (V / V), and the medium was MM and MM-N respectively. The temperature of the chemostat culture is 30°C, the pH is automatically controlled at 5.6 by dropping 10.0M NaOH or 2M HCl, the rotation speed is maintained at 600rpm, the ventilation rate is 100L / h (about 0.98VVM), the dissolved oxygen is maintained at 85% saturation, and the dilution rate is 0.085. After about 10 working volumes, samples were collected. The samples were collected by centrifugation at 4°C and 8000rpm for 5 minutes. About 0.7g of wet bacteria could be collect...
Embodiment 2
[0105] Embodiment 2: Cloning of Rhodotorula graminearum rgrfas1 and rgrfas2 genes
[0106] Gene-specific primers were designed according to the nucleotide sequences of rgrfas1 and rgrfas2 as follows:
[0107] rgrfas1-Fw: atgaacggtcaccacaccccgtgccggcacc
[0108] rgrfas1-Rv: tcactggatcgccgagaagacgtcgagctt
[0109] rgrfas2-Fw: atggcggccgaccttccgctcgcgctgagc
[0110] rgrfas2-Rv: ctacgagcgagcgatgacgacggcgacggc
[0111] The total RNA of R. toruloides CGMCC2.1389 was extracted by liquid nitrogen grinding plus RNaiso method [Yang F, Tan HD, Zhou YJ, Lin XP, ZhangSF.Mol.Biotechnol.2010, 47(2):144-151]. The RNA was subjected to 1.5% agarose gel electrophoresis, observed and identified using a fluorescence-ultraviolet analyzer, and two clear bands could be seen. The total RNA sample was analyzed with an ultraviolet / visible light spectrometer, and OD260 / OD280=1.9 was measured, indicating that the total RNA was of good quality. Total RNA samples were stored frozen at -80°C for later u...
Embodiment 3
[0115] Example 3: Prokaryotic expression, protein purification and oil production performance analysis of Rhodotorula graminearum fatty acid synthase
[0116] According to the rgrfas1 nucleotide sequence design primers with corresponding restriction sites (the underlined part of the primer rgrfas1-NcoI-F is the NcoI restriction site, and the underlined part of the primer rgrfas1-HindIII-R is the HindIII restriction site), sequence as follows:
[0117] rgrfas1-NcoI-F: ctct ccatgg atgaacggtcaccacaccccgtgccggcacc
[0118] rgrfas1-HindIII-R:tct aagctt tcactggatcgccgagaagacgtcgagctt
[0119] According to the rgrfas2 nucleotide sequence, primers with corresponding restriction sites were designed (the underlined part of the primer rgrfas2-NdeI-F is the NdeI restriction site, and the underlined part of the primer rgrfas2-AvrII-R is the AvrII restriction site), the sequence as follows:
[0120] rgrfas2-NdeI-F: ctct catatg gcggccgaccttccgctcgcgctgagc
[0121] rgrfas2-AvrII-R:t...
PUM
| Property | Measurement | Unit |
|---|---|---|
| molecular weight | aaaaa | aaaaa |
| molecular weight | aaaaa | aaaaa |
| molecular weight | aaaaa | aaaaa |
Abstract
Description
Claims
Application Information
Login to View More 