Unlock instant, AI-driven research and patent intelligence for your innovation.

Oleaginous yeast fatty acid synthase, and coding gene and application thereof

A technology of fatty acid synthase and oleaginous yeast, applied in application, genetic engineering, plant gene improvement, etc., can solve problems such as increasing the oil content of recombinant strains

Active Publication Date: 2014-09-10
DALIAN INST OF CHEM PHYSICS CHINESE ACAD OF SCI
View PDF4 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0004] The researchers found that genes encoding isocitrate dehydrogenase (IDH) and malic enzyme (ME) from oleaginous microorganisms (Rhodosporidium toruloides and Liposporidium steerii) were expressed during oil accumulation in indigenous bacteria cerevisiae functional complementation analysis also proved that these genes can increase the oil content of recombinant strains, but failed to successfully transform a non-oleaginous strain into an oleaginous strain [Yang F, Zhang SF, Zhou YJ, Zhu ZW, Lin XP, Zhao ZK.Appl.Microbiol.Biotechnol.2012, 94(4), 1095-1105]

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Oleaginous yeast fatty acid synthase, and coding gene and application thereof
  • Oleaginous yeast fatty acid synthase, and coding gene and application thereof
  • Oleaginous yeast fatty acid synthase, and coding gene and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0099] Example 1: Discovery of Rhodotorula graminearum fatty acid synthase

[0100] R. graminis ATCC MYA-4893 was revived on YEPD solid medium, cultured upside down at 30°C for 48 hours, picked a single colony and inoculated in 50ml YEPD liquid medium (filled in a 250ml Erlenmeyer flask), and cultured at 30°C, 200rpm for 28h. The culture medium was transferred to a 2L continuous fermenter (working volume 1.7L) with automatic feeding at a ratio of 1:50 (V / V), and the medium was MM and MM-N respectively. The temperature of the chemostat culture is 30°C, the pH is automatically controlled at 5.6 by dropping 10.0M NaOH or 2M HCl, the rotation speed is maintained at 600rpm, the ventilation rate is 100L / h (about 0.98VVM), the dissolved oxygen is maintained at 85% saturation, and the dilution rate is 0.085. After about 10 working volumes, samples were collected. The samples were collected by centrifugation at 4°C and 8000rpm for 5 minutes. About 0.7g of wet bacteria could be collect...

Embodiment 2

[0105] Embodiment 2: Cloning of Rhodotorula graminearum rgrfas1 and rgrfas2 genes

[0106] Gene-specific primers were designed according to the nucleotide sequences of rgrfas1 and rgrfas2 as follows:

[0107] rgrfas1-Fw: atgaacggtcaccacaccccgtgccggcacc

[0108] rgrfas1-Rv: tcactggatcgccgagaagacgtcgagctt

[0109] rgrfas2-Fw: atggcggccgaccttccgctcgcgctgagc

[0110] rgrfas2-Rv: ctacgagcgagcgatgacgacggcgacggc

[0111] The total RNA of R. toruloides CGMCC2.1389 was extracted by liquid nitrogen grinding plus RNaiso method [Yang F, Tan HD, Zhou YJ, Lin XP, ZhangSF.Mol.Biotechnol.2010, 47(2):144-151]. The RNA was subjected to 1.5% agarose gel electrophoresis, observed and identified using a fluorescence-ultraviolet analyzer, and two clear bands could be seen. The total RNA sample was analyzed with an ultraviolet / visible light spectrometer, and OD260 / OD280=1.9 was measured, indicating that the total RNA was of good quality. Total RNA samples were stored frozen at -80°C for later u...

Embodiment 3

[0115] Example 3: Prokaryotic expression, protein purification and oil production performance analysis of Rhodotorula graminearum fatty acid synthase

[0116] According to the rgrfas1 nucleotide sequence design primers with corresponding restriction sites (the underlined part of the primer rgrfas1-NcoI-F is the NcoI restriction site, and the underlined part of the primer rgrfas1-HindIII-R is the HindIII restriction site), sequence as follows:

[0117] rgrfas1-NcoI-F: ctct ccatgg atgaacggtcaccacaccccgtgccggcacc

[0118] rgrfas1-HindIII-R:tct aagctt tcactggatcgccgagaagacgtcgagctt

[0119] According to the rgrfas2 nucleotide sequence, primers with corresponding restriction sites were designed (the underlined part of the primer rgrfas2-NdeI-F is the NdeI restriction site, and the underlined part of the primer rgrfas2-AvrII-R is the AvrII restriction site), the sequence as follows:

[0120] rgrfas2-NdeI-F: ctct catatg gcggccgaccttccgctcgcgctgagc

[0121] rgrfas2-AvrII-R:t...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
molecular weightaaaaaaaaaa
molecular weightaaaaaaaaaa
molecular weightaaaaaaaaaa
Login to View More

Abstract

The invention discloses oleaginous yeast fatty acid synthase and a coding gene and application thereof. The fatty acid synthase is composed of an RgrFAS1 subunit and an RgrFAS2 subunit. The RgrFAS1 subunit is protein shown in (a) or (b): (a) protein composed of an amino acid sequence shown in SEQ ID No. 1; and (b) protein derived from the SEQ ID No. 1 through substitution and / or deletion and / or addition of one or more amino acids of the SEQ ID No. 1 and having functions identical to functions of a fatty acid synthase subunit 1. The RgrFAS2 subunit is protein shown in (c) or (d): (c) protein composed of an amino acid sequence shown in SEQ ID No. 2; and (d) protein derived from the SEQ ID No. 2 through substitution and / or deletion and / or addition of one or more amino acids of the SEQ ID No. 2 and having functions identical to functions of a fatty acid synthase subunit 2.

Description

technical field [0001] The invention belongs to the field of biotechnology, and relates to an oleaginous yeast fatty acid synthase and its gene and application. Specifically, the oleaginous yeast fatty acid synthase and the nucleotide encoding it are derived from Rhodotorula graminis. The invention also provides a method for constructing the recombinant cell for oil production. Background technique [0002] Grease is a renewable resource with low oxygen content, high energy density, and moderate carbon chain length. It can replace fossil resources as the basic processing raw material for the chemical industry and renewable energy industry. It is a transition from a carbon-hydrogen economy to a carbon-hydrogen economy. The important link of its market potential is huge. Some microorganisms in nature can store more than 20% of their dry cell weight in cells under certain conditions (such as nitrogen source deficiency), among which triacylglycerol (TAG) is the main one. Micro...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N9/10C12N15/54C12N15/63C12N1/21C12N1/19C12R1/645
CPCC12N9/1029C12Y203/01085
Inventor 赵宗保朱志伟张素芳
Owner DALIAN INST OF CHEM PHYSICS CHINESE ACAD OF SCI