Salt-tolerant protease-resistant α-galactosidase agaahj8 and its gene

A galactosidase and protease technology, applied in the field of genetic engineering, can solve the problems of low equipment utilization rate, raw material utilization rate, low amino nitrogen yield, long fermentation cycle, etc., and achieve the effect of good salt resistance and protease resistance characteristics.

Active Publication Date: 2018-01-19
YUNNAN NORMAL UNIV
View PDF2 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

For example, the soy sauce produced by the high-salt dilute state process has high quality and good flavor. The concentration of sodium chloride in the soy sauce or moromi reaches 18% (w / v). The raw materials for making soy sauce contain endogenous protease, which can be added during fermentation Exogenous protease and galactosidase, but because the enzyme activity is inhibited under the condition of high concentration of sodium chloride, the fermentation of high-salt dilute soy sauce has long fermentation cycle, low equipment utilization rate, raw material utilization rate and amino nitrogen production Low efficiency and other shortcomings (patent: 201110248389.8)

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Salt-tolerant protease-resistant α-galactosidase agaahj8 and its gene
  • Salt-tolerant protease-resistant α-galactosidase agaahj8 and its gene
  • Salt-tolerant protease-resistant α-galactosidase agaahj8 and its gene

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0033] Example 1: Cloning of α-galactosidase gene agaAHJ8

[0034]Extracting the genomic DNA of marine bacilli: centrifuge the bacterial liquid cultured in liquid for 2 days to take the bacterial cells, add 1mL lysozyme, treat at 37°C for 60min, and then add the lysate, the lysate consists of: 50mM Tris, 20mM EDTA, 500mM NaCl, 2% ( w / v) SDS, pH 8.0, lysed in a water bath at 70°C for 60 minutes, mixed every 10 minutes, and centrifuged at 10,000 rpm for 5 minutes at 4°C. The supernatant was extracted in phenol / chloroform to remove impurity proteins, and then an equal volume of isopropanol was added to the supernatant. After standing at room temperature for 5 minutes, centrifuge at 10,000 rpm for 10 minutes at 4°C. The supernatant was discarded, the precipitate was washed twice with 70% ethanol, dried in vacuum, dissolved by adding an appropriate amount of TE, and stored at -20°C for later use.

[0035] 5 μg of the marine bacilli genome was broken into 400–600 bp fragments with ...

Embodiment 2

[0037] Embodiment 2: Preparation of recombinant α-galactosidase AgaAHJ8

[0038] 5'CAACAGAAGGCATCCCTTGCCCCC 3' and 5'GATCTTTTTGAGGCGGAAAAGCTTTG 3' were used as primer pairs and the genomic DNA of Marine bacteria was used as template for PCR amplification. The PCR reaction parameters were: denaturation at 94°C for 5 min; then denaturation at 94°C for 30 sec, annealing at 65°C for 30 sec, extension at 72°C for 2 min and 30 sec, and after 30 cycles, incubation at 72°C for 10 min. As a result of PCR, the α-galactosidase gene agaAHJ8 was obtained, and a protruding A base was introduced at the 3' end of the gene. The α-galactosidase gene agaAHJ8 and the expression vector pEasy-E2 were connected by T-A method to obtain the recombinant expression plasmid pEasy-E2-agaAHJ8 containing agaAHJ8. Transform pEasy-E2-agaAHJ8 into Escherichia coli BL21(DE3) to obtain recombinant Escherichia coli strain BL21(DE3) / agaAHJ8.

[0039] Take the recombinant Escherichia coli strain BL21(DE3) / agaAHJ8...

Embodiment 3

[0040] Example 3: Determination of the properties of the purified recombinant α-galactosidase AgaAHJ8

[0041] 1. Activity analysis of purified recombinant α-galactosidase AgaAHJ8

[0042] The activity determination method of the purified recombinant α-galactosidase AgaAHJ8 adopts the pNPG method: dissolve pNPG in 0.1M buffer solution to make the final concentration 2mM; After preheating at the reaction temperature for 5min, add enzyme solution and react for 10min, then add 2mL 1M Na 2 CO 3 The reaction was terminated, and the released pNP was measured at a wavelength of 405 nm after cooling to room temperature; 1 enzyme activity unit (U) was defined as the amount of enzyme required to decompose pNPG to produce 1 μmol pNP per minute. The method for measuring the activity of the substrate raffinose and guar gum adopts the DNS method: the substrate is dissolved in 0.1M buffer solution to make the final concentration 0.5%; the reaction system contains 50 μL of an appropriate am...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
molecular weightaaaaaaaaaa
Login to View More

Abstract

The invention discloses a salt-resistant proteinase-resistant alpha-galactosidase AgaAHJ8 and a gene thereof. The invention provides an alpha-galactosidase AgaAHJ8 of which the amino acid sequence is disclosed as SEQ ID NO.1, a gene agaAHJ8 for coding the alpha-galactosidase, a recombinant vector comprising the gene, and a recombinant strain comprising the gene. The alpha-galactosidase can maintain the enzyme activity at 72% above when the pH value is 4.0-8.0. The optimum temperature is 50 DEG C, and the alpha-galactosidase is stable at 37 DEG C. The alpha-galactosidase has favorable salt resistance and proteinase resistance, and can hydrolyze melibiose, raffinose and guar gum. The alpha-galactosidase AgaAHJ8 is applicable to the field of processing of high-salt food and marine products, and is especially applicable to fermentation of high-salt food (such as high-salt diluted soy sauce).

Description

technical field [0001] The invention relates to the technical field of genetic engineering, in particular to a salt-resistant and protease-resistant α-galactosidase AgaAHJ8 and its gene. Background technique [0002] Oligosaccharides and polysaccharides with α-galactoside are widely found in food and feed materials, especially legume seeds have the highest content (Karr-Lilienthal et al., Livest Prod Sci, 2005, 97:1– 12.), such as oligosaccharides such as melibiose, raffinose, stachyose and verbascose, and galactomannans such as carob gum and guar gum. α-galactosidase (α-galactosidase, EC 3.2.1.22), also known as melibiase, can catalyze the hydrolysis of α-galactosidic bonds in these oligosaccharide and polysaccharide substrates, and then apply In feed, food, paper and medical industries (Zhou et al., Appl Microbiol Biotechnol, 2010, 88:1297–1309). [0003] Salt-tolerant enzymes still have catalytic activity under high concentrations of NaCl, and can be used in high-salt f...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityPatents(China)
IPC IPC(8): C12N9/40C12N15/56C12N15/70C12N15/81C12N15/75C12N15/74C12N1/21
CPCC12N9/2465C12Y302/01022
Inventor周峻沛张蕊黄遵锡陆倩唐湘华李俊俊吴倩
OwnerYUNNAN NORMAL UNIV