Double-lipase cell surface co-display engineering bacterium, and construction method and application thereof

A technology of cell surface and lipase, which is applied in the field of double lipase cell surface co-display engineering bacteria and its construction, can solve the problems of high cost, loss of activity, complicated extraction separation and purification process, etc., and achieve high catalytic efficiency and catalytic reaction short time effect

Inactive Publication Date: 2015-11-18
NANJING FORESTRY UNIV
View PDF4 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, the enzyme-catalyzed method has problems such as complex and high-cost extraction, separation and purification of the enzyme, and easy loss of enzyme activity during the preparation process. Therefore, in recent years, whole-cell biocatalysis methods that directly use lipase production strains or cells as catalyst It has become an important development direction, especially the microbial cell surface display technology developed in recent years provides a new biological method based on gene recombination technology for whole-cell catalysis and enzyme immobilization

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Double-lipase cell surface co-display engineering bacterium, and construction method and application thereof
  • Double-lipase cell surface co-display engineering bacterium, and construction method and application thereof
  • Double-lipase cell surface co-display engineering bacterium, and construction method and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0034] Saccharomyces cerevisiae S.cerevisiaeEBY100 genome extraction, the steps are as follows:

[0035] (1) S. cerevisiae EBY100 was purchased from Invitrogen. First, activate the strain on the YPD plate, pick a single colony in the YPD shake flask, and culture overnight at 30°C.

[0036] (2) The bacterial cells in the logarithmic growth phase were centrifuged at 5000 rpm / min for 5 minutes, the bacterial cells were washed once with sterile distilled water, and the supernatant was removed.

[0037] (3) Add 5 mL of DNA breaking buffer (100 mmol / LTris-HCl, pH 8.0, 10 mmol / LEDTA, 1% SDS), mix well, and incubate at 65° C. for 1 h.

[0038] (4) Centrifuge at 10,000 rpm for 15 minutes, and take the supernatant.

[0039] (5) Add phenol chloroform isoamyl alcohol (25:24:1) to extract twice, and centrifuge at 5000rpm for 7min each time.

[0040] (6) Take the upper layer extract, add 6 μL RNaseA (10 mg / mL), and precipitate with 3 times ethanol overnight (add 0.3 mol / L sodium acetate,...

Embodiment 2

[0044] The construction of Rhizopus oryzae lipase (ROL) Pichia pastoris cell surface display system, the steps are as follows:

[0045] A. Construction of surface display recombinant plasmid vector pPICZαA-ROL

[0046] The lipase gene ROL from Rhizopus oryzae was cloned and fused with plasmid pPICZαA. The primers were designed according to the plasmid pPIC9K-ROL containing the lipase gene sequence of Rhizopus oryzae, and the primers were synthesized by Shanghai Sangong Bioengineering Co., Ltd.

[0047] R1 (5'-3', the same below): CCGGAATTCATGGTTCCTGTTTCTGGTAAATCTG, add EcoRI restriction site in front.

[0048] R2: TCCCCGCGG ATGATGATGATGATGATG CAAACAGCTTCCTTCGTTGATATCA, add SacⅡ restriction site and His-tag tag protein (underlined part) in front.

[0049] PCR amplification with synthetic primers, PCR reaction system: 1 μL plasmid pPIC9K-ROL, 1 μL R1 primer, 1 μL R2 primer, 25 μL PremixExtaq, 22 μL ddH 2 O. Amplification conditions were: denaturation at 94°C for 2min; dena...

Embodiment 3

[0061] The construction of Candida antarctica lipase B (CALB) Pichia pastoris surface display system, the steps are as follows:

[0062] A. Construction of surface display recombinant plasmid vector pGAPZαA-CALB

[0063] Cloning of the Candida antarctica lipase B gene CALB, fused to pGAPZαA. The primers were designed according to the lipase B gene sequence of Candida antarctica, and the primers were synthesized by Shanghai Sangon Bioengineering Co., Ltd.

[0064] C1: CCGGAATTCATGAAGCTACTCTCTCTGACCGGTG, with an EcoRI restriction site added in front.

[0065] C2: AAGGAAAAAAGCGGCCGCTGGGGGTGACGATGCCGGAGC, with a NotⅠ restriction site added in front.

[0066] Using Candida antarctica genomic DNA as a template, PCR amplification was performed with synthetic primers). PCR reaction system: 1 μL Candida antarctica genomic DNA, 1 μLC1 primer, 1 μLC2 primer, 25 μL PremixExtaq, 22 μL ddH 2 O. Amplification conditions were: denaturation at 94°C for 2min; denaturation at 94°C for 30s; ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a double-lipase cell surface co-display engineering bacterium, and a construction method and application thereof. The engineering bacterium is co-displayed on the Pichia pastoris cell surface by using Saccharomyces cerevisiae cell wall protein Sed1p as ankyrin and Rhizopus oryzae lipase and Candida antarctica lipase B as double-lipase target proteins, thereby constructing the double-lipase cell surface co-display recombinant yeast engineering bacterium. The Rhizopus oryzae lipase and Candida antarctica lipase B are co-displayed on the Pichia pastoris cell wall surface to prepare the Rhizopus oryzae lipase / Candida antarctica lipase B cell surface co-display complete cell catalyst. The maximum enzyme activity of the surface co-display complete cell catalyst is 686U / g-cell dry weight, which is respectively 3 times or 2 times of the enzyme activity of the independently displayed Rhizopus oryzae lipase or Candida antarctica lipase B; and the methyl ester yield of the catalytic grease esterification reaction is up to 96%.

Description

technical field [0001] The invention belongs to the technical fields of molecular biology, biomass energy, genetic engineering and the like, and specifically relates to a dual-lipase cell surface co-display engineering bacterium and its construction method and application. Background technique [0002] Lipase (Lipase, EC3.1.1.3) is an enzyme related to the hydrolysis, synthesis and transesterification of triglycerides, which widely exists in animals, plants and microorganisms. Catalytic reactions at the interface. As a green catalyst, lipase has been successfully used in the fields of oil processing, organic synthesis, cosmetics and medicine, and has also been widely used in the research of preparing biodiesel in recent years. Among lipases derived from fungi, Candida antarctica lipase B (Candida antarctica lipase B, CALB) has chemoselectivity and enantioselectivity, and has strong catalytic activity for water-insoluble and water-soluble substances. Rhizopus oryzae lipase ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C12N1/19C12N15/81C12P7/64C12R1/84
CPCY02E50/10
Inventor王飞李文谦丁怀海时号李迅张瑜
OwnerNANJING FORESTRY UNIV