Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Strain capable of producing alpha-L-rhamnosidase and method for producing alpha-L-rhamnosidase by adopting strain through fermentation

A technology of rhamnosidase and bacterial strain, which is applied in the field of food biology, can solve the problems of high price of pure enzyme and the application and development of restriction enzyme, and achieve the effects of simple fermentation process, broad market application prospect and convenient cultivation

Inactive Publication Date: 2015-12-23
JIANGNAN UNIV
View PDF3 Cites 8 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0004] So far, α-L-rhamnosidase has not been produced on a large scale due to the limitations of strains and fermentation conditions, so the pure enzyme is expensive, which limits the application and development of this enzyme

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0020] Alternaria alternatus ( Alternaria alternata ) SK37.002 is fermented under the following conditions:

[0021] Slope culture: PDA medium (each component is counted in g / L): potato 200, glucose 20, agar 15-20, pH natural, prepared with deionized water, sterilized at 115°C for 30 minutes. The culture conditions are: culture temperature 25~35℃, culture time 3~8 days;

[0022] Seed culture: use seed medium (each component is in g / L): NaNO 3 2,K 2 HPO 4 1, KCl0.5, MgSO 4 0.5, FeSO 4 0.1, sucrose 30, pH natural, prepared with deionized water, sterilized at 121°C for 20 minutes; seed culture conditions: cultivated on a shaker at 30°C, 200rpm for 12h;

[0023] Fermentation culture: use fermentation medium (each component is in g / L): naringin 1, sucrose 5, sodium nitrate 5, dipotassium hydrogen phosphate 0.8, calcium chloride 0.7, potassium chloride 0.5, magnesium sulfate 0.5, FeSO 4 0.1, natural pH; prepared with deionized water, sterilized at 121°C for 20min; fermentati...

Embodiment 2

[0024] Embodiment 2 α-L-rhamnosidase enzyme powder preparation:

[0025] The bacteria containing α-L-rhamnosidase obtained in Example 1 was filtered and washed, dissolved in the buffer solution, ultrasonically crushed with a 10cm probe for 10min, centrifuged at 10000r / min for 10min, and separated and precipitated with 20% to 70% ammonium sulfate Target protein, buffer dialysis, DEAE-FF16 / 10 ion exchange chromatography, Superdex75 gel filtration chromatography, and finally freeze-drying the obtained liquid to obtain α-L-rhamnosidase.

[0026] SEQ ID NO.1

[0027] 1

[0028] 519

[0029] DNA

[0030] Alternaria alternaria ( Alternaria alternata ) SK37.002

[0031] 1

[0032] gaggtcaaagttgaaaaaaaggcttaatggatgctagacctttgctgatagagagtgcga60

[0033] cttgtgctgcgctccgaaaccagtaggccggctgccaattactttaaggcgagtctccag120

[0034] caaagctagagacaagacgcccaacaccaagcaaagcttgagggtacaaatgacgctcga180

[0035] acaggcatgccctttggaataccaaagggcgcaatgtgcgttcaaagattcgatgattca240

[0036] ctg...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to a strain capable of producing alpha-L-rhamnosidase and a method for producing alpha-L-rhamnosidase by adopting the strain through fermentation, belonging to the technical field of food biology. The invention discloses the strain capable of producing alpha-L-rhamnosidase. The classification name of the strain is Alternaria alternata SK 37.002, is preserved in China Center for Type Culture Collection with preservation number of CCTCC NO:M2015309. A fermentation culture medium taking sucrose and naringoside as carbon sources is used for fermenting Alternaria alternata SK 37.002, namely CCTCC NO:M2015309 to obtain the strain containing alpha-L-rhamnosidase; and the strain is broken, and alpha-L-rhamnosidase is separated and purified. The produced alpha-L-rhamnosidase is safe and reliable, is a functional product with market potential, and can be widely applied to the industries of foods, medicines, biology and the like. The strain can be used for efficiently producing alpha-L-rhamnosidase, and is suitable for large-scaled production.

Description

technical field [0001] The present invention relates to a bacterial strain producing α-L-rhamnosidase, and a method for fermenting and producing α-L-rhamnosidase by using the bacterial strain, in particular to Alternaria alternata ( Alternaria alternata ) SK37.002 The method for producing α-L-rhamnosidase belongs to the field of food biotechnology. Background technique [0002] α-L-rhamnosidase (EC3.2.1.40) is a hydrolase that can hydrolyze the non-reducing α-L-rhamnosidic bond bound to the end of the substrate, releasing rhamnose and the corresponding Ligand. α-L-rhamnosidase has a wide range of sources and is widely distributed in bacteria, fungi, and animal livers in nature. In addition, α-L-rhamnosidase is a plant cell wall pectin polysaccharide, glycoprotein and secondary metabolites such as flowers A component of compounds such as cyanosides, flavonoids, and triterpenes, and also often exists in the repeating units of bacterial heteropolysaccharides, rhamnolipids, an...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N1/14C12N9/24C12R1/645
Inventor 张涛江波袁文博沐万孟缪铭
Owner JIANGNAN UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com