Strain capable of producing alpha-L-rhamnosidase and method for producing alpha-L-rhamnosidase by adopting strain through fermentation
A technology of rhamnosidase and bacterial strain, which is applied in the field of food biology, can solve the problems of high price of pure enzyme and the application and development of restriction enzyme, and achieve the effects of simple fermentation process, broad market application prospect and convenient cultivation
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Examples
Embodiment 1
[0020] Alternaria alternatus ( Alternaria alternata ) SK37.002 is fermented under the following conditions:
[0021] Slope culture: PDA medium (each component is counted in g / L): potato 200, glucose 20, agar 15-20, pH natural, prepared with deionized water, sterilized at 115°C for 30 minutes. The culture conditions are: culture temperature 25~35℃, culture time 3~8 days;
[0022] Seed culture: use seed medium (each component is in g / L): NaNO 3 2,K 2 HPO 4 1, KCl0.5, MgSO 4 0.5, FeSO 4 0.1, sucrose 30, pH natural, prepared with deionized water, sterilized at 121°C for 20 minutes; seed culture conditions: cultivated on a shaker at 30°C, 200rpm for 12h;
[0023] Fermentation culture: use fermentation medium (each component is in g / L): naringin 1, sucrose 5, sodium nitrate 5, dipotassium hydrogen phosphate 0.8, calcium chloride 0.7, potassium chloride 0.5, magnesium sulfate 0.5, FeSO 4 0.1, natural pH; prepared with deionized water, sterilized at 121°C for 20min; fermentati...
Embodiment 2
[0024] Embodiment 2 α-L-rhamnosidase enzyme powder preparation:
[0025] The bacteria containing α-L-rhamnosidase obtained in Example 1 was filtered and washed, dissolved in the buffer solution, ultrasonically crushed with a 10cm probe for 10min, centrifuged at 10000r / min for 10min, and separated and precipitated with 20% to 70% ammonium sulfate Target protein, buffer dialysis, DEAE-FF16 / 10 ion exchange chromatography, Superdex75 gel filtration chromatography, and finally freeze-drying the obtained liquid to obtain α-L-rhamnosidase.
[0026] SEQ ID NO.1
[0027] 1
[0028] 519
[0029] DNA
[0030] Alternaria alternaria ( Alternaria alternata ) SK37.002
[0031] 1
[0032] gaggtcaaagttgaaaaaaaggcttaatggatgctagacctttgctgatagagagtgcga60
[0033] cttgtgctgcgctccgaaaccagtaggccggctgccaattactttaaggcgagtctccag120
[0034] caaagctagagacaagacgcccaacaccaagcaaagcttgagggtacaaatgacgctcga180
[0035] acaggcatgccctttggaataccaaagggcgcaatgtgcgttcaaagattcgatgattca240
[0036] ctg...
PUM

Abstract
Description
Claims
Application Information

- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com