Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Improved specific activity mutant thermophilic thermophilic alkaline pectate lyase gene, engineering bacterium, enzyme and their application

A technology of pectin lyase and genetically engineered bacteria, applied in the directions of genetic engineering, lyase, application, etc., can solve the problem of few reports of thermophilic pectinase, and achieve the effect of increasing the amount of fermentation

Inactive Publication Date: 2016-03-02
JILIN UNIV
View PDF2 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0005] At present, pectin lyases are mainly alkaline enzymes, and most of them are normal temperature enzymes, and there are few thermophilic enzymes. So far, there are many reports on thermophilic cellulase, but few reports on thermophilic pectinase

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Improved specific activity mutant thermophilic thermophilic alkaline pectate lyase gene, engineering bacterium, enzyme and their application
  • Improved specific activity mutant thermophilic thermophilic alkaline pectate lyase gene, engineering bacterium, enzyme and their application
  • Improved specific activity mutant thermophilic thermophilic alkaline pectate lyase gene, engineering bacterium, enzyme and their application

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0036] Example 1: Construction of thermophilic engineering bacteria and expression of enzymes

[0037] (1) Primer design and acquisition of thermophilic alkaline pectin lyase gene PelC by PCR method

[0038] Using the genome of Fusobacterium thermofusobacterium CaldicellulosiruptorbesciiDSM6725 as a template, primers were designed to amplify the PelC-CD gene by PCR method, and the amplified product was subjected to agarose gel electrophoresis, and 600 bp was recovered and purified. Sequencing showed that the size of the fragment was 603 bp, and its sequence As shown in the sequence table SEQ ID NO.1.

[0039] The sequences of the upstream primers are as follows:

[0040] Upstream Primer 1:

[0041] 5'GGAATTC CATATG GGTGGTGTTTTAGTTATTACAGATACAATAATTG3'

[0042] (The underlined base is the recognition sequence of NdeI digestion);

[0043] The sequences of the downstream primers are as follows:

[0044] Downstream primer 2:

[0045] 5'CCG CTCGAG TCAGTGGTGGTGGTGGTGGTGCTCGA...

Embodiment 2

[0065] Example 2: Properties of Mutant Thermophilic Alkaline Pectin Lyase

[0066] The enzyme activity determination method of mutant thermophilic alkaline pectin lyase described in embodiment 1 is specifically as follows:

[0067] Substrate preparation: Weigh 0.2g of polygalacturonic acid and place it in a 100mL beaker, add about 80mL of 50mM Gly and stir to dissolve it, adjust the pH to 9.5 with 1mol / L NaOH, and dilute the solution to 100mL with a volumetric flask , dubbed 0.2% (w / v) of the substrate.

[0068] Control group: add 100μL, 0.8mM, CaCl to 800μL substrate 2 , preheat at 70°C for 1 min, add 100 μL, 20 mM, pH 8.0 Tris-HCl, and measure the absorbance at 235 nm within 2 min;

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention belongs to the technical field of biological engineering and relates to an improved specific activity mutant thermophilic thermophilic alkaline pectate lyase gene, engineering bacterium, enzyme and their application. The engineering bacterium is collected under CGMCC No. 11461, has a classification name Escherichia coli and is collected in China General Microbiological Culture Collection Center on 29th September, 2015. The invention mainly discloses a mutant thermophilic thermophilic alkaline pectate lyase, a most suitable reaction temperature is 70 DEG C, a most suitable Ca2+ concentration is 0.8 mM, a substrate is 0.2%(w / v) polygalacturonic acid, and pH is 9.5. This lyase has an enzyme specific activity of 5300 U / mg at pH 9.5 under Ca2+ 0.8 mM; the lyase has a half-life of 6 h at the held temperature of 70 DEG C; after the lyase is purified with nickel columns, CbPelC-CD is up to 40 mg / L (1L of fermentation liquor). The specific activity of the mutant thermophilic thermophilic alkaline pectate lyase is greatly improved with respect to a proenzyme CbPelC (900 U / mg), the lyase is more satisfactory to modern industrial production, and an effective method is also provided for the industrial large-scale production of alkaline pectinase.

Description

technical field [0001] The invention belongs to the technical field of bioengineering, and in particular relates to a mutant thermophilic alkaline pectin lyase gene with improved specific activity, engineering bacteria, enzyme and application thereof in degrading pectin substances. Background technique [0002] Pectin substances are mainly composed of polygalacturonic acid (GalA), and the side chains often contain trehalose, rhamnose, arabinose, etc., which are widely present in primary plant cell walls. [0003] Pectinase is a general term for a series of enzymes that decompose pectin substances, and is widely distributed in higher plants and microorganisms. During the process of plant maturation, pectinase makes the plant cell wall softer, and also plays an important role in the balance of plant tissue corruption and regeneration. Pectinases can be divided into two categories according to their mode of action, namely esterases and depolymerases, and depolymerases are furt...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N15/60C12N1/21C12N15/70C12N9/88C12R1/19
Inventor 张作明李海超张静李正强于擎
Owner JILIN UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com