Lilium regale inducible promoter and application thereof
A promoter, inducible technology, applied in the research fields of molecular biology and genetic engineering, can solve the problems of protein accumulation, waste of energy, etc., and achieve broad application prospects and the effect of protecting plants
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Example Embodiment
[0023] Example 1: Cloning and sequence analysis of Lilium Minjiang inducible promoter LrP1
[0024] Using the extracted Lilium Minjiang root genomic DNA as a template, using specific primers for amplifying the promoter LrP1 (upstream primer: 5'TCGAGTTTGGTGTTATTGTTATTAG3', downstream primer: 5'GATGTGTTTGAGAAGGAGGTGT3') as upstream and downstream primers, the promoter was cloned by PCR Sequence of LrP1. The reaction system (20 μL) is Lilium Minjiang genomic DNA 0.5 μg, 2 μL 10×Advantage 2 PCR Buffer, 1.8 μL dNTP Mix (10mM each), 0.2 μL upstream primer (10 μM), 0.2 μL downstream primer (10 μM), 0.2 μL Advantage 2 PCR Polymerase Mix, 14.6 μL PCR-Grade water. PCR reaction conditions: 94℃ 5 min; 94℃ 30 s, 65℃ 30 s, 72℃ 2 min, 32 cycles; 72℃ 5 min. After PCR, take 8 μL for agarose gel electrophoresis to detect the specificity and size of the amplified product.
[0025] The PCR product obtained has only one DNA band, so the PCR product is directly cloned by TA. The kit used is pGEM-T ve...
Example Embodiment
[0028] Example 2: LrP1 -GUS Expression vector construction
[0029] pBI121 multiple cloning site has Hin dⅢ and Bam HⅠ restriction site, so the specific primers of the amplifying promoter are added separately Hin dⅢ and Bam HI recognition site. The E. coli plasmid pGEM-T-LrP1 inserted into LrP1 and the plant expression vector pBI121 plasmid were extracted using the SanPrep column plasmid DNA small extraction kit (Shanghai Shenggong), and 1 μL was used for agarose gel electrophoresis to detect the extraction. The integrity and concentration of the plasmid. Restriction endonuclease Bam HⅠand Hin dⅢ The plasmids pGEM-T-LrP1 and pBI121 were double-enzyme digested (100 μL system). The reaction system and operation process were as follows: Take 20 μL pGEM-T-LrP1 and pBI121 plasmids respectively, and sequentially add 10 μL 10×H buffer, 5 μL Bam HⅠ, 5 μL Hin dⅢ, 60 μL ddH 2 O, centrifuge for a short time after mixing, and place at 37°C for overnight reaction. All the digested ...
Example Embodiment
[0032] Example 3: Agrobacterium-mediated plant genetic transformation and transgenic plant screening
[0033] The transgenic recipient in this experiment is tobacco. Tobacco seeds are soaked in 75% alcohol for 30 s, washed with sterile water and then washed with 0.1% HgCl 2 Soak for 8 min, then wash it with sterile water several times, sow on 1 / 2 MS medium, cultivate in the dark at 28°C for 5-8 d, transfer to a light incubator (25°C, 16h / d light) after germination, Substituting MS medium once a month thereafter.
[0034] Store pBI121-LrP1 in the refrigerator at -80℃ -GUS The Agrobacterium LBA4404 bacterial solution of the plasmid was taken out, and 10 μL of bacterial solution was inoculated in 1 mL of LB liquid medium containing 20 mg / L rifampicin and 50 mg / L Km. The culture was shaken at 28 ℃ at 200 rpm until it became turbid. Pipette 500 μL of bacterial solution evenly on the LB solid medium containing 20 mg / L rifampicin and 50 mg / L Km, and invert the culture at 28°C until a law...
PUM
Login to view more Abstract
Description
Claims
Application Information
Login to view more - R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap