Unlock instant, AI-driven research and patent intelligence for your innovation.

Polysaccharide hydrolase gene from pyrococcus horikoshii and application

A hydrolytic enzyme and gene technology, applied in the field of bioengineering and enzyme engineering, can solve the problems of refractory degradation and low efficiency, and achieve the effect of wide application

Active Publication Date: 2017-04-05
JILIN UNIV
View PDF2 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, because cellulose is insoluble in water and forms crystals, making it difficult to degrade, the cost of cellulase due to the low efficiency of cellulase has become the most critical issue in the production of clean fuels from cellulosic resources such as straw

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Polysaccharide hydrolase gene from pyrococcus horikoshii and application
  • Polysaccharide hydrolase gene from pyrococcus horikoshii and application
  • Polysaccharide hydrolase gene from pyrococcus horikoshii and application

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0020] Example 1: Genomic DNA extraction of the extreme thermophilic anaerobic archaea T.kodakarensis KOD1

[0021] Cultivate an appropriate amount of thermophilic archaea T.kodakarensisKOD1, collect the bacteria by centrifugation at 4000rpm for 10 minutes, wash the bacteria twice with Washing TE (50mmol / LTris-HCl pH8.0, 10mmol / LEDTA pH8.0), and then fully suspend the bacteria Add 0.5ml 5mg / L protease and 0.5ml 10% SDS to 5ml 1×TE buffer, mix gently, place at 50°C for 3h-5h, then extract twice with an equal volume of Tris-saturated phenol, Extract once with phenol / chloroform / isoamyl alcohol. After extracting once with chloroform, precipitate DNA with ethanol. Use the tip of an automatic pipette to absorb the flocculent DNA pellet into an Ep tube, wash twice with 70% ethanol, and dissolve after drying. in 25 μL ddH 2 O middle.

Embodiment 2

[0022] Embodiment 2: the cloning of polysaccharide hydrolase gene Tk1765 and the construction of expression vector

[0023] (1) Primer design: According to the conserved region of the homologous sequence of the polysaccharide hydrolase gene, primers were designed in combination with the vector used, and EcoRI and NotI restriction sites (underlined parts) were introduced at the 5' ends of the primers:

[0024] Upstream primer: 5'-CCG GAATTC GTGAAGAAGATTTGG (SEQ ID NO: 3)

[0025] Downstream primer: 5'-TT GCGGCCGC AA TCAAACTGGAACTGCAACTG (SEQ ID NO: 4)

[0026] (2) PCR amplification: PCR amplification was performed using the genomic DNA of the extreme thermophilic anaerobic archaea T.kodakarensis KOD1 as a template, and the PCR reaction system (25 μL) was as follows:

[0027] 10×Ex Tag Buffer 2.5 μL, 2.5 mmol / L dNTPs mixture 1 μL, 10 μmol / L upstream and downstream primers 1 μL each, ExTag DNA amplification enzyme 0.5 μL, template 10-100ng, sterile deionized water 18 μL. P...

Embodiment 3

[0029] Example 3: Construction, screening and induced expression of yeast engineering strain expressing polysaccharide hydrolase gene Tk1765

[0030] (1) Linearization of the recombinant expression plasmid: the recombinant expression plasmid pPIC9K-Tk1765 was linearized with the restriction endonuclease SalI.

[0031] (2) Transformation: Yeast competent cells of the yeast strain PichiapastoriSGS115 were transformed by electric shock. For the transformation method, refer to the Pichia pastoris operation manual of nvitrogen company.

[0032](3) Screening: Use a sterilized toothpick to pick the corresponding spots of transformants on MM and MD plates, incubate at 30°C for 2-4 days, and pick transformants that grow well on both MD / MM plates as positive transformants. Pick positive transformants and plant them on 1mg / mL, 2mg / mL, 3mg / mL, 4mg / mL G418 YPD plates to screen for multi-copy transformants, and obtain yeast engineering strains expressing polysaccharide hydrolase gene Tk1765...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention belongs to the technical field of bioengineering and enzyme engineering, and discloses a polysaccharide hydrolase gene from pyrococcus horikoshii and application. A nucleotide sequence of the polysaccharide hydrolase gene Tk1765 is shown as SEQ ID NO:1. A coding sequence of the polysaccharide hydrolase gene Tk1765 is shown as SEQ ID NO:2. Polysaccharide hydrolase has the efficient cellulose gum and chitose double digest character. According to cellulose gum of the polysaccharide hydrolase, the optimum pH value is 10.0, and the optimum enzyme reaction temperature is 65 DEG C. According to hydrolysis chitose, the optimum pH value is 11.0, and the optimum enzyme reaction temperature is 80 DEG C. The hydrolase is heated for 4 h at the temperature being 100 DEG C, and the activity of the hydrolase can be kept to be 40% or above. A recombinant vector of the hydrolase is constructed and excessively expressed in pichia pastoris, a product of the hydrolase has the function of hydrolyzing maize straw, and the polysaccharide hydrolase and the coding gene thereof can be widely applied to cellulose and chitin degradation.

Description

technical field [0001] The invention belongs to the technical field of bioengineering and enzyme engineering, and specifically relates to a polysaccharide hydrolase and its encoding gene, a recombinant vector containing the encoding gene, a genetic engineering strain, and its biological activity and application. Background technique [0002] Among the thermostable enzymes of archaea, enzymes related to carbohydrate metabolism have received extensive attention, and these enzymes mainly include cellulase, amylase, chitinase and some glycosidic transferases. In starch processing, the liquefaction of starch needs to be carried out at high temperature. At present, the amylases used in industrial production are mainly produced by mesophilic Bacillus and its mutants, and its optimum reaction temperature is 90-95°C, while the extreme thermostable amylase from Pyrococcus woesei can be catalyzed at 130°C, It is still active after heating at 120°C for 5 hours. In addition to the adva...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N15/56C12N9/42C12N15/81C12N1/19C12Q1/34C12P19/14C12P19/02C12R1/84
CPCC12N9/2434C12P19/02C12P19/14C12Q1/34G01N2333/942
Inventor 张世宏李正群魏毅陈丽娜张鑫生宋妍悦
Owner JILIN UNIV