Unlock instant, AI-driven research and patent intelligence for your innovation.

Protein of esterase EstK1 and application thereof

A technology of protein and esterase, applied in the direction of application, enzyme, hydrolase, etc., can solve the problems of low conversion rate and long reaction time

Active Publication Date: 2017-06-13
OCEAN UNIV OF CHINA
View PDF5 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, the current enzymatic preparation of cinnamyl acetate mainly uses lipase catalysis, which has the problems of low conversion rate and long reaction time, which may be related to the preference of lipase for long-chain fatty acids.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Protein of esterase EstK1 and application thereof
  • Protein of esterase EstK1 and application thereof
  • Protein of esterase EstK1 and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0032] Embodiment 1: the construction of gene library and the analysis of lipolytic enzyme sequence

[0033] In the previous study, our laboratory screened a high-yielding esterase strain (OUC_Estk) and identified it as Acinetobacter haemolyticus. Genomic DNA of the bacterium was extracted, incompletely digested with Sau3AI restriction enzyme, and a 2-7kb DNA fragment was recovered. The recovered fragment was ligated into pBluescript IISK(+) vector which was completely digested with BamHI and dephosphorylated with alkaline phosphatase. The recombinant vector was introduced into DH5α competent cells, and spread on the LB ampicillin-resistant solid plate containing tributyrin. After standing in a 37°C incubator for 1-2 days, pick positive clones with obvious transparent circles for culture, extract plasmids and send them for sequencing. After the sequencing, through ORF prediction and BLASTP alignment, a lipolytic enzyme full-length gene with a size of 1071bp was obtained. Ph...

Embodiment 2

[0034] Example 2: Cloning, expression and purification of esterase EstK1

[0035] According to the obtained full-length EstK1 gene, design the full-length primer of the gene, upstream primer: CGC GGATCC ATGTTTGCATTGAATGAATCACTTA (BamHI restriction site), downstream primer: CCC AAGCTT TTAACTACGTTTATCCCAAAAATTTACG (HindIII restriction site). The digested target fragments were respectively ligated with pET21a(+), pET28a(+), pET32a(+) vectors cut with the same restriction enzymes, and the recombinant plasmids were finally introduced into BL21(DE3) for induced expression. After induction of expression, the bacteria were broken, and by enzyme activity detection, it was found that all three vectors could express active esterase. Because the protein content expressed by pET32a(+) was higher, pET32a(+) was selected as the final expression vector. . The recombinant protein EstK1 was purified.

[0036] The gel electrophoresis of the above-mentioned esterase EstK1 is as follows: f...

Embodiment 3

[0037] Embodiment 3: Research on the enzymatic properties of esterase EstK1

[0038] (1) Study on substrate specificity of esterase EstK1

[0039] In 100mM pH 8.0 Tris-HCl buffer, pNP esters (C2, C4, C8, C10, C12, C14, C16) with different carbon chain lengths were used for detection to see the preference of esterase EstK1 for carbon chain length. Such as image 3 As shown in a, the esterase EstK1 shows the highest activity to C4, and the activity to pNP long-chain esters with >10 carbons is very low, indicating that the esterase EstK1 is an esterase.

[0040] (2) Optimum pH

[0041] The purified esterase EstK1 was tested using different pH buffers to detect the optimum pH of EstK1. The reaction process uses pNPB (C4) as the substrate, and the different pH buffers are: sodium phosphate buffer (pH 6, 7, 8), Tris-HCl buffer (pH 8, 9) and Na 2 CO 3 -NaHCO 3 Buffer (pH 9, 10). Such as image 3 As shown in b, the optimum pH of EstK1 is 8.0, and EstK1 shows higher activity in...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
recovery rateaaaaaaaaaa
Login to View More

Abstract

The invention provides protein of esterase EstK1 and application thereof, and discloses an amino acid sequence and a nucleotide sequence of novel esterase EstK1. As the esterase has favorable tolerance and high transesterification activity in a hydrophobic organic solvent, the EstK1 is used for preparing ethyl ester perfume; as the EstK1 has the capacity of preparing cinnamyl acetate in a high-efficiency catalysis manner, most cinnamyl alcohol can be converted into cinnamyl acetate within 2h; the recovery rate of the cinnamyl acetate reaches 97.1 percent. Further, the research of the substrate spectrum of the protein shows that the EstK1 can be used for preparing n-octanol ethyl ester, 2-phenethyl alcohol ethyl ester, citronellol ethyl ester, geraniol ethyl ester and the like; the esterase EstK1 is implied to have the potential of preparing the ethyl ester perfume.

Description

technical field [0001] The invention belongs to the technical field of functional enzyme screening, and in particular relates to an esterase EstK1 protein and its application. Background technique [0002] Esterase (Esterase; EC 3.1.1.1) is a kind of lipolytic enzyme, which can catalyze the hydrolysis and synthesis of ester bonds, and widely exists in animals, plants and microorganisms. Both lipase and esterase belong to lipolytic enzymes. They catalyze the synthesis and hydrolysis of ester bonds in the same mechanism. Synthesis of water-soluble short-chain glycerides (carbon chain length <10). In the water phase, the esterase catalyzes the hydrolysis reaction, and in the organic phase, it can catalyze the esterification, transesterification, transesterification and aminolysis reactions. Because of its good substrate specificity, stereoselectivity and regioselectivity, esterase has become an important industrial enzyme and is widely used in food, medicine, detergent and...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N9/18C12N15/55C12N15/70C12N1/21C12P7/62
CPCC12N9/18C12N15/70C12N2800/101C12P7/62C12Y301/01001
Inventor 毛相朝董浩孙建安薛长湖
Owner OCEAN UNIV OF CHINA