A recombinant strain of Pichia pastoris expressing xylanase derived from streptomyces sp.FA1
A technology of Pichia pastoris and xylanase, applied in the field of genetic engineering, can solve the problems such as the expression of episomal expression plasmids that have not yet been seen, and achieve the improvement of the ability to secrete and produce xylanase, the production cost is low, and the specific activity is improved. Effect
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0034] Example 1: Construction of expression vector pGAPZαA-PARS
[0035] The self-replicating sequence PARS with nucleotide sequence as shown in SEQ ID NO.2 was synthesized by whole gene synthesis technology; the recovered PARS gene fragment was connected with plasmid pGAPZαA by infusion enzyme to construct the expression vector pGAPZαA-PARS.
Embodiment 2
[0036] Example 2: Construction of free-type pGAPZαA-PARS-XynA recombinant bacteria
[0037] Construction of recombinant plasmid pGAPZαA-PARS-XynA:
[0038] The plasmid pMD18-T-XynA (A xylanase from Streptomyces sp.FA1: heterologous expression, characterization, and its application in Chinese steamed bread, YangXu, Journal of Industrial Microbiology & Biotechnology, May 2016, Volume43, Issue5, pp 663-670) was used as the template A forward primer with the sequence shown in SEQ ID NO.3: CCGGAATTCATGGCCGAGAACACCCTT, and a reverse primer with the sequence shown in SEQ ID NO.4: ATTTGCGGCCGCTCAGGTGCGGGTCCAGCGTT were designed. The XynA fragment with Not I and EcoR I restriction sites was obtained by polymerase chain reaction.
[0039]PCR reaction system (50μL):
[0040]
[0041] PCR program: 94°C, 4min (pre-denaturation); 98°C, 10s (denaturation); 60°C, 5s (annealing); 72°C, 90s (extension); set 30 cycles; set after 72°C, 10min (insulation) The storage temperature is 4°C. The ...
Embodiment 3
[0049] Example 3: Construction of integrated pGAPZαA-XynA recombinant bacteria
[0050] Construction of recombinant plasmid pGAPZαA-XynA:
[0051] Using the plasmid pMD18-T-XynA as a template, design a forward primer with the sequence shown in SEQ ID NO.3: CCGGAATTCATGGCCGAGAACACCCTT, and a reverse primer with the sequence shown in SEQ ID NO.4: ATTTGCGGCCGCTCAGGTGCGGGTCCAGCGTT. The XynA fragment with Not I and EcoR I restriction sites was obtained by polymerase chain reaction.
[0052] PCR reaction system (50μL):
[0053]
[0054] PCR program: 94°C, 4min (pre-denaturation); 98°C, 10s (denaturation); 60°C, 5s (annealing); 72°C, 90s (extension); set 30 cycles; set after 72°C, 10min (insulation) The storage temperature is 4°C. The PCR product was gel-recovered and digested to recover the target gene, which was digested with the expression vector pGAPZαA and ligated overnight at 16°C, transformed into E.coliJM109, coated with an LB plate containing zecoin resistance, and cul...
PUM

Abstract
Description
Claims
Application Information

- Generate Ideas
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com