Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

A recombinant strain of Pichia pastoris expressing xylanase derived from streptomyces sp.FA1

A technology of Pichia pastoris and xylanase, applied in the field of genetic engineering, can solve the problems such as the expression of episomal expression plasmids that have not yet been seen, and achieve the improvement of the ability to secrete and produce xylanase, the production cost is low, and the specific activity is improved. Effect

Active Publication Date: 2020-06-09
JIANGNAN UNIV
View PDF1 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

At present, in the expression system of Pichia pastoris, the xylanase gene is constructed into an integrated recombinant strain for recombinant expression of exogenous genes, and no episomal expression plasmid has been used for expression.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • A recombinant strain of Pichia pastoris expressing xylanase derived from streptomyces sp.FA1
  • A recombinant strain of Pichia pastoris expressing xylanase derived from streptomyces sp.FA1
  • A recombinant strain of Pichia pastoris expressing xylanase derived from streptomyces sp.FA1

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0034] Example 1: Construction of expression vector pGAPZαA-PARS

[0035] The self-replicating sequence PARS with nucleotide sequence as shown in SEQ ID NO.2 was synthesized by whole gene synthesis technology; the recovered PARS gene fragment was connected with plasmid pGAPZαA by infusion enzyme to construct the expression vector pGAPZαA-PARS.

Embodiment 2

[0036] Example 2: Construction of free-type pGAPZαA-PARS-XynA recombinant bacteria

[0037] Construction of recombinant plasmid pGAPZαA-PARS-XynA:

[0038] The plasmid pMD18-T-XynA (A xylanase from Streptomyces sp.FA1: heterologous expression, characterization, and its application in Chinese steamed bread, YangXu, Journal of Industrial Microbiology & Biotechnology, May 2016, Volume43, Issue5, pp 663-670) was used as the template A forward primer with the sequence shown in SEQ ID NO.3: CCGGAATTCATGGCCGAGAACACCCTT, and a reverse primer with the sequence shown in SEQ ID NO.4: ATTTGCGGCCGCTCAGGTGCGGGTCCAGCGTT were designed. The XynA fragment with Not I and EcoR I restriction sites was obtained by polymerase chain reaction.

[0039]PCR reaction system (50μL):

[0040]

[0041] PCR program: 94°C, 4min (pre-denaturation); 98°C, 10s (denaturation); 60°C, 5s (annealing); 72°C, 90s (extension); set 30 cycles; set after 72°C, 10min (insulation) The storage temperature is 4°C. The ...

Embodiment 3

[0049] Example 3: Construction of integrated pGAPZαA-XynA recombinant bacteria

[0050] Construction of recombinant plasmid pGAPZαA-XynA:

[0051] Using the plasmid pMD18-T-XynA as a template, design a forward primer with the sequence shown in SEQ ID NO.3: CCGGAATTCATGGCCGAGAACACCCTT, and a reverse primer with the sequence shown in SEQ ID NO.4: ATTTGCGGCCGCTCAGGTGCGGGTCCAGCGTT. The XynA fragment with Not I and EcoR I restriction sites was obtained by polymerase chain reaction.

[0052] PCR reaction system (50μL):

[0053]

[0054] PCR program: 94°C, 4min (pre-denaturation); 98°C, 10s (denaturation); 60°C, 5s (annealing); 72°C, 90s (extension); set 30 cycles; set after 72°C, 10min (insulation) The storage temperature is 4°C. The PCR product was gel-recovered and digested to recover the target gene, which was digested with the expression vector pGAPZαA and ligated overnight at 16°C, transformed into E.coliJM109, coated with an LB plate containing zecoin resistance, and cul...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses Pichia yeast recombinant bacteria for expressing Streptomyces sp. FA1 (fertilization antigen 1) source xylanase, and belongs to the field of gene engineering. Plasmid pMD18-T-XynA serves as a template, a primer is designed, PCR (polymerase chain reaction) amplification is performed to obtain a target gene, and the nucleotide sequence of the gene is as shown in SEQ ID NO: 1 in a sequence table. The invention further discloses a production method of recombinant Pichia yeast engineering bacteria. The production method includes the steps: (1) synthesizing an autonomously replicating sequence PARS by whole gene synthesis technology; (2) building an expression vector pGAPZ alpha A-PARS; (3) building a recombinant expression vector pGAPZ alpha A-PARS-XynA; (4) transforming Pichia yeast hosts and screening positive converters; (5) shake-flask induced cultivation; (6) horizontally inducing a recombinant Pichia yeast engineering bacteria fermentation tank to produce the xylanase.

Description

technical field [0001] The invention relates to a Pichia pastoris recombinant bacterium expressing xylanase derived from Streptomyces sp.FA1, which belongs to the field of genetic engineering. Background technique [0002] Xylanase belongs to the class of glycoside hydrolases [EC 3.2.1.x] and can be used in various fields. Adding xylanase and other hemicellulase to the feed is beneficial to increase the decomposition of feed nutrients; in the pulp and paper industry, xylanase can be used as a pre-bleaching agent to treat pulp, thereby reducing the use of chemical reagents in the pulp bleaching process It can reduce the pollution to the environment; it can be used in the baking of flour products in the food field, which can improve the quality of flour products; xylanase is also used to prepare xylooligosaccharides. Hemp plants are rich in cellulose, which is the fiber raw material in the textile industry, but hemicellulose, lignin, pectin and other impurities in hemp plants...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12N1/19C12N9/24C12N15/81A23K10/18C12R1/84
CPCA23K10/18C12N9/2402C12N15/815C12Y302/01
Inventor 吴敬吴丹潘阳
Owner JIANGNAN UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com