Preparation method and application of Swollenin protein sourced from Trichoderma Guizhouense
A protein, Trichoderma technology, applied in the field of Swollenin protein preparation, can solve the problem of unclear protein regulation molecular mechanism, and achieve the effect of being conducive to pollution-free production, improving the ability of colonization and functioning, and increasing income
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0046] Example 1 Heterologous expression of swollenin gene in Escherichia coli in Trichoderma Guizhou NJAU4742
[0047] 1. Cloning and sequencing verification of swollenin gene
[0048] 1) Obtain the sequence of the swollenin gene of Trichoderma Guizhou NJAU4742 by querying the whole genome database of Trichoderma Guizhou NJAU4742 (http: / / bioinfo.njau.edu.cn / tgn4742 / );
[0049] 2) Using molecular biology software, analyze the characteristics of the swollenin gene, and obtain the protein sequence and signal peptide position of the gene;
[0050] The cDNA sequence of the swollenin gene is: SEQ ID NO.1, the protein sequence encoded by the swollenin gene is: SEQ ID NO.2, and the signal peptide of the Swollenin protein is: SEQ ID NO.3
[0051] 3) Collect the mycelium of Trichoderma T.guizhouense NJAU 4742 cultured on the PDA plate for 7 days, extract DNA, and use high-fidelity enzyme (TakaRa) to carry out PCR amplification and clone. PCR primers: swoF: ATGGCTCGTAAACTTAGTCT; swoR:...
Embodiment 2
[0083] Example 2 Knockout of Trichoderma harzianum NJAU 4742 swollenin gene and its influence on Trichoderma colonization in cucumber roots
[0084]1 Based on the principle of homologous recombination, construct the swollenin gene knockout vector: clone the ≈1.3kb homology arm from the upstream and downstream of the target gene swollenin respectively, and then clone the hygromycin B anti- The expression cassette (hph cassette, ≈2.3kb), the 3 fragments were connected by overlapping-PCR technology. The upper and lower homology arm cloning PCR system settings are as follows:
[0085] 2×CloneAmp HiFi PCR Premix——12.5μl
[0086] Primer F (10 μM)——1 μl
[0087] Primer R (10 μM)——1 μl
[0088] gDNA (200ngμl -1 )——1μl
[0089] Add ultrapure water to 25 μl.
[0090] The PCR reaction conditions were set as follows:
[0091]
[0092] The hph cassette expression cassette cloning PCR system is set as follows:
[0093] 2×CloneAmp HiFi PCR Premix——12.5μl
[0094] Primer F (10 μM)...
Embodiment 3
[0138] Example 3 Overexpression of Trichoderma harzianum NJAU 4742 swollenin gene and the influence of Trichoderma on colonization of cucumber roots Using the full-length cDNA sequence of Trichoderma NJAU 4742 swollenin gene, design primers (swoOF: CATGCCATGGCTCGTAAACTTAGTCT (SEQ ID NO.14); swoOR : GGGTTACCATAGTTTTGACTAAACTGT (SEQ ID NO.15)), and design NcoI and BstEII restriction sites at both ends of the primers, use Trichoderma NJAU 4742cDNA as PCR template and use high-fidelity enzyme (TakaRa) to amplify swollenin gene. The swollenin gene was cloned into the back of the expression vector pCAMBIA1302 promoter by restriction endonuclease ligation, and the recombinant expression plasmid pCAMBIA1302:swo was constructed (for the steps, please refer to the construction of the above-mentioned pET32a-swol expression vector).
[0139] 2. First prepare the competent Agrobacterium, transfer the constructed recombinant plasmid pCAMBIA-1302:swo into the competent Agrobacterium by electr...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 



