Unlock instant, AI-driven research and patent intelligence for your innovation.

Preparation method and application of Swollenin protein sourced from Trichoderma Guizhouense

A protein, Trichoderma technology, applied in the field of Swollenin protein preparation, can solve the problem of unclear protein regulation molecular mechanism, and achieve the effect of being conducive to pollution-free production, improving the ability of colonization and functioning, and increasing income

Inactive Publication Date: 2018-09-28
NANJING AGRICULTURAL UNIVERSITY
View PDF9 Cites 1 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, most of the research at this stage is about the role of root exudates in plant metabolism or the tropism response to different signaling molecules, and about the regulation of proteins that break through the immune response of plants during the interaction between Trichoderma and plants. The molecular mechanism is not yet clear

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Preparation method and application of Swollenin protein sourced from Trichoderma Guizhouense
  • Preparation method and application of Swollenin protein sourced from Trichoderma Guizhouense
  • Preparation method and application of Swollenin protein sourced from Trichoderma Guizhouense

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0046] Example 1 Heterologous expression of swollenin gene in Escherichia coli in Trichoderma Guizhou NJAU4742

[0047] 1. Cloning and sequencing verification of swollenin gene

[0048] 1) Obtain the sequence of the swollenin gene of Trichoderma Guizhou NJAU4742 by querying the whole genome database of Trichoderma Guizhou NJAU4742 (http: / / bioinfo.njau.edu.cn / tgn4742 / );

[0049] 2) Using molecular biology software, analyze the characteristics of the swollenin gene, and obtain the protein sequence and signal peptide position of the gene;

[0050] The cDNA sequence of the swollenin gene is: SEQ ID NO.1, the protein sequence encoded by the swollenin gene is: SEQ ID NO.2, and the signal peptide of the Swollenin protein is: SEQ ID NO.3

[0051] 3) Collect the mycelium of Trichoderma T.guizhouense NJAU 4742 cultured on the PDA plate for 7 days, extract DNA, and use high-fidelity enzyme (TakaRa) to carry out PCR amplification and clone. PCR primers: swoF: ATGGCTCGTAAACTTAGTCT; swoR:...

Embodiment 2

[0083] Example 2 Knockout of Trichoderma harzianum NJAU 4742 swollenin gene and its influence on Trichoderma colonization in cucumber roots

[0084]1 Based on the principle of homologous recombination, construct the swollenin gene knockout vector: clone the ≈1.3kb homology arm from the upstream and downstream of the target gene swollenin respectively, and then clone the hygromycin B anti- The expression cassette (hph cassette, ≈2.3kb), the 3 fragments were connected by overlapping-PCR technology. The upper and lower homology arm cloning PCR system settings are as follows:

[0085] 2×CloneAmp HiFi PCR Premix——12.5μl

[0086] Primer F (10 μM)——1 μl

[0087] Primer R (10 μM)——1 μl

[0088] gDNA (200ngμl -1 )——1μl

[0089] Add ultrapure water to 25 μl.

[0090] The PCR reaction conditions were set as follows:

[0091]

[0092] The hph cassette expression cassette cloning PCR system is set as follows:

[0093] 2×CloneAmp HiFi PCR Premix——12.5μl

[0094] Primer F (10 μM)...

Embodiment 3

[0138] Example 3 Overexpression of Trichoderma harzianum NJAU 4742 swollenin gene and the influence of Trichoderma on colonization of cucumber roots Using the full-length cDNA sequence of Trichoderma NJAU 4742 swollenin gene, design primers (swoOF: CATGCCATGGCTCGTAAACTTAGTCT (SEQ ID NO.14); swoOR : GGGTTACCATAGTTTTGACTAAACTGT (SEQ ID NO.15)), and design NcoI and BstEII restriction sites at both ends of the primers, use Trichoderma NJAU 4742cDNA as PCR template and use high-fidelity enzyme (TakaRa) to amplify swollenin gene. The swollenin gene was cloned into the back of the expression vector pCAMBIA1302 promoter by restriction endonuclease ligation, and the recombinant expression plasmid pCAMBIA1302:swo was constructed (for the steps, please refer to the construction of the above-mentioned pET32a-swol expression vector).

[0139] 2. First prepare the competent Agrobacterium, transfer the constructed recombinant plasmid pCAMBIA-1302:swo into the competent Agrobacterium by electr...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a preparation method and an application of Swollenin protein sourced from Trichoderma Guizhouense, wherein the Swollenin protein can be expressed in Escherichia coli at high efficient; the electrophoresis-pure target protein can be acquired through nickel column affinity chromatography. The Swollenin protein can significantly increase the colonization capability of Trichoderma at rhizosphere of cucumbers, solves the problem of poor rhizospheric colonization effect of a Trichoderma fertilizer in large field application. In addition, through fermentation with Escherichiacoli, yield can be further increased, thus providing theoretical basis for large-scale industrial application.

Description

technical field [0001] The invention belongs to the field of biological reagent manufacturing, and relates to a preparation method and application of Swollenin protein from Trichoderma Guizhou. Background technique [0002] my country is a big country in the use of chemical fertilizers, ranking first in the world. However, the utilization rate of chemical fertilizers is only maintained at about 30%. Such a low utilization rate of chemical fertilizers not only causes huge economic losses, but also brings serious environmental and agricultural product safety problems. Bio-organic fertilizer is a special organic fertilizer containing specific functional microbial strains. The product not only contains decomposed organic fertilizer, but also contains a specified number of functional bacteria. It is an organic unity of microbial fertilizer and organic fertilizer. On the one hand, the application of organic fertilizer solves the outlet for a large number of organic pollutants, and...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C07K14/37C07K1/113C07K1/22C12N15/70C05G3/00A01N63/04A01P21/00
CPCA01N63/30C05G3/00C07K14/37C12N15/70
Inventor 沈其荣孟晓慧刘东阳缪有志冉炜
Owner NANJING AGRICULTURAL UNIVERSITY