Preparation method of milk goat mammary gland bioreactor for expressing GP5-M protein in milk

A bioreactor, GP5-M technology, applied in the field of goat mammary gland bioreactor preparation, can solve the problems of microbial processing, high price of active substances, inability to synthesize active protein, etc., to achieve large output, low cost, and maintain biological active effect

Inactive Publication Date: 2018-10-02
NORTHWEST A & F UNIV
View PDF1 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0005] Although the cost of medicinal proteins produced by bacteria and yeast is low, these microorganisms cannot perform precise post-transcriptional processing and cannot synthesize many active proteins, while the active substances produced by mammalian cells in vitro are extremely expensive

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Preparation method of milk goat mammary gland bioreactor for expressing GP5-M protein in milk
  • Preparation method of milk goat mammary gland bioreactor for expressing GP5-M protein in milk
  • Preparation method of milk goat mammary gland bioreactor for expressing GP5-M protein in milk

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0079] Construction of gene targeting vector

[0080] (1) Cloning of GP5-M gene

[0081] With reference to the GP5 and M protein gene sequences of the American representative strain of porcine reproductive and respiratory syndrome virus (PRRSV) VR2332 in GenBank, 2 pairs of primers SEQ ID NO:1-SEQ ID NO:4 were designed and synthesized. The primer sequences are as follows:

[0082] GP5 gene amplification primers:

[0083] Forward: TGTATCGTGCCGTTCTATCTTG; SEQ ID NO: 1

[0084] Reverse: GCAGTTCTTCGCAAGCCTAAT; SEQ ID NO: 2

[0085] M gene amplification primers:

[0086] Forward: TCGGGTACATGACATTCGTGC; SEQ ID NO:3

[0087] Reverse: TGCCGCAATCGGATGAAA; SEQ ID NO: 4

[0088] Extract viral genomic RNA, use random primers to reverse transcribe cDNA, use the cDNA as a template, use the above primers, and use the RT-PCR method, that is, the reaction conditions: 98°C for 3min; 98°C for 10sec, 54°C for 30sec, 72°C for 50sec (30Cycles) ; 72°C for 10 minutes; 4°C forever.

[0089] React...

Embodiment 2

[0096] Goat Fetal Fibroblasts Transfected with Targeting Vector pBT-GP5-M

[0097] Goat fetal fibroblasts are isolated from fetal tissues at 40 days of pregnancy, that is, the goat fetuses are collected by cesarean section, the limbs, head and internal organs are removed, the tissue pieces are cut into pieces and cultured, and the cells are frozen after confluence. Thaw primary goat fetal fibroblasts from liquid nitrogen at 38°C, centrifuge, discard the supernatant, add cell culture medium DMEM / F12+10% FBS to resuspend, take the cell suspension and inoculate it in a 6-well plate, place in 38°C in an incubator, 5% CO 2 cultivated under conditions. When the 1-3 generations of goat fetal fibroblasts reach 80% confluence, discard the culture medium and use Ca-free 2+ , Mg 2+ Rinse the cells with PBS, add trypsin digestion solution, and digest the cells. Observe the cells under an inverted microscope. When most of the cells retract, become round, and the intercellular space exp...

Embodiment 3

[0099] PCR identification of target cells

[0100] Design identification primers such as image 3 As shown, use PCR to amplify the sequence at the junction of the targeting vector and the genome, confirm that the targeting vector is correctly integrated into the targeting site, the amplified sequence spans the homology arm, and the 5'junction identification upstream primer is designed outside the 5' homology arm On the genome, the downstream primer is located on the target gene GP5; the 3'junction identification upstream primer is designed on the neo gene, and the downstream primer is located on the genome outside the 3' homology arm;

[0101] The sequences of the above identification primers are as follows:

[0102] 5'junction identification primers (PCR product 1226bp):

[0103] Forward: TAGCAACGCCCAAGTGGATTC; SEQ ID NO:5

[0104] Reverse: AAGCAACTGGCTGGTGGTGAG; SEQ ID NO: 6

[0105] 3'junction identification primer (PCR product 2388bp)

[0106] Forward: CCACCAAGCGAAACA...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

No PUM Login to view more

Abstract

The invention discloses a preparation method of a milk goat mammary gland bioreactor for expressing a GP5-M protein in milk. A gene targeting vector of fusion expression of GP5-M is prepared and thenknocked into a first exon of beta-lactoglobulin of a milk goat to screen target cells; a transgenetic milk goat is prepared by using a somatic nucleus transplantation technology; the mammary gland bioreactor is used for producing milk containing a GP5-M fusion protein; and the pure GP5-M fusion protein is separated from the milk, and an adjuvant is added, so as to prepare a gene engineered subunitvaccine and fulfill the aim of preventing and controlling PRRS.

Description

technical field [0001] The invention relates to the technical field of animal genetic engineering, in particular to a method for preparing a goat mammary gland bioreactor expressing GP5-M fusion protein in milk. Background technique [0002] Porcine reproductive and respiratory syndrome (PRRS), commonly known as porcine blue ear disease, is a highly contagious infectious disease caused by porcine reproductive and respiratory syndrome virus (PRRSV), clinically manifested as Reproductive disorders such as late abortion, premature birth, stillbirth and mummification in sows, severe respiratory symptoms in piglets, and high mortality. The disease is widespread all over the world and has caused huge economic losses to the pig industry. According to nucleotide sequence differences, the virus can be divided into two genotypes, European and American. A series of PRRSV strains isolated in my country are mostly of the American type, causing huge economic losses to my country. In 200...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
Patent Type & Authority Applications(China)
IPC IPC(8): C12N15/85C12N15/65C12N15/90C12N15/873C12N15/62A01K67/027C07K19/00A61K39/12A61P31/14
CPCC12N15/85A01K67/0278A01K2217/072A01K2227/102A01K2267/01A61K39/12A61K2039/552A61P31/14C07K14/005C07K2319/00C07K2319/21C12N9/22C12N15/62C12N15/65C12N15/873C12N15/907C12N2770/10022C12N2770/10034C12N2800/107C12N2800/30C12N2830/50
Inventor 张涌刘军葛恒涛苏建民王勇胜权富生
Owner NORTHWEST A & F UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap