Microbial population sensing signal quenching bacteria and application thereof as biocontrol bacteria

A quorum sensing signal and signal technology, applied in the direction of microorganism-based methods, microorganisms, chemicals for biological control, etc., can solve the problems of degradation characteristics and quenching mechanisms that need to be studied, and the types are limited, so as to protect crops and human beings Healthy, environmentally friendly, and good application prospects

Active Publication Date: 2018-11-06
SOUTH CHINA AGRI UNIV
View PDF10 Cites 6 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0005] At present, the types of quorum quenching bacteria that can degrade DSF signal molecules are limited, and more quorum quenching bacteria that can efficiently degrade DSF signal molecules need to be further isolated and identified, and their degradation characteristics and quenching mechanisms need to be studied

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Microbial population sensing signal quenching bacteria and application thereof as biocontrol bacteria
  • Microbial population sensing signal quenching bacteria and application thereof as biocontrol bacteria
  • Microbial population sensing signal quenching bacteria and application thereof as biocontrol bacteria

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0040] Example 1 Isolation and screening of Burkholderia cepacia bacterial strain F25

[0041] 1. Isolation and purification of bacterial strains

[0042] (1) Soil sample collection: The sweet potato field soil cultivated for many years was collected as the microbial source.

[0043] The soil samples were collected on March 16, 2017 from the sweet potato field soil cultivated all year round in Nanhai District and Shunlugang, Foshan City, Guangdong Province. The soil from the surface layer to the depth of 5 cm was sampled, bagged, and preserved as a microbial source for strain isolation.

[0044] (2) Enrichment culture of strains: Prepare MSM medium, put 50 mL of MSM medium into a 250 mL Erlenmeyer flask for sterilization, add DSF mother solution under aseptic conditions after cooling (the concentration of the mother solution is 100mM, methanol is the solvent ), so that the final mass concentration of DSF was 0.01mM, and at the same time, 5 g of soil samples were added, and af...

Embodiment 2

[0055] Example 2 Identification of Burkholderia cepacia strain F25

[0056] 1. Morphological identification of strain F25

[0057] (1) Colony morphological characteristics: Streak the above strain F25 on LB solid medium and culture at 30°C for 48 h. Such as figure 1 As shown, the color of the colony is yellow-green, and the colony is slightly raised, indicating that it is smooth and opaque with neat edges. Strain F25 was diffusely turbid and aerobic in LB broth.

[0058] (2) Morphological characteristics of bacteria: such as figure 2 As shown, the cells are rod-shaped, or short spherical, with a size of (0.5-1.0)×(0.3-0.5) μm.

[0059] 2. Phylogenetic analysis of strain F25

[0060] 16S rDNA sequence and phylogenetic analysis: the genome of the strain F25 was extracted as a template, and the 16S rDNA PCR amplification of the strain was carried out using bacterial universal primers 27F (AGAGTTTGATCCTGGCTCAG) and 1492R (GGTTACCTTGTTACGACTT), and the 16S rDNA gene sequenc...

Embodiment 3

[0062] Antibiotic susceptibility analysis of embodiment 3 bacterial strain F25

[0063] In order to better study the biocontrol potential of the bacterial strain F25 obtained in Examples 1 and 2, we studied the antibiotic sensitivity of the bacterial strain F25. The result is as Figure 4As shown, the resistance of the strain F25 to gentamicin (GEN), neomycin sulfate (NEO), carbenicillin (CARB), ampicillin (AMP) and streptomycin (STR) reached 400 μg / mL or more, the resistance to kanamycin (KAN) reaches 200 μg / mL, and the resistance to tetracycline (TC) and chloramphenicol (CM) reaches 50 μg / mL. This result is helpful for selecting appropriate antibiotics as a reference in follow-up studies.

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses microbial population sensing signal quenching bacteria and application thereof as biocontrol bacteria. Through study, the invention finds that Burkholderia cepacia has an obvious degradation effect on a population sensing signal molecule DSF; meanwhile, the Burkholderia cepacia F25 for efficiently degrading the DSF signal molecule is obtained by screening. The strain was preserved in the Guangdong Province Microbiological Culture Center on April 3, 2018, with a preservation number of GDMCC No:60346. The bacteria can quickly and efficiently degrade the DSF, and has population sensing and quenching functions and remarkable biocontrol effects on DSF pathogenic diseases such as black rot caused by xanthomonas campestris XC1. The microbial population sensing signal quenching bacteria disclosed by the invention can replace a chemical control method and eliminate potential safety hazards of antibiotic use, is environmentally-friendly and has important application valuefor preventing and treating plant diseases caused by pathogens relying on the DSF.

Description

technical field [0001] The invention belongs to the technical field of plant disease biological control. More specifically, it relates to a microbial quorum sensing signal quenching bacterium, which is a strain of Burkholderia cepacia that efficiently degrades the quorum sensing signal molecule DSF ( Burkholderia cepacia ) F25, and its application as biocontrol bacteria. Background technique [0002] Quorum sensing (QS) is ubiquitous in microorganisms and regulates important biological functions such as biofilm formation, cell growth, synthesis of extracellular products, bioluminescence, and production of virulence factors. Studies have shown that all these regulatory processes contribute to the pathogenicity of microorganisms, thus having a major impact on agricultural production, the environment and human health. DSF (Diffusible SignalFactor) family QS system is a conserved cell communication system that widely exists in Gram-negative bacteria, and it has attracted mor...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): A01N63/00A01P1/00C12N1/20C12R1/01
CPCA01N63/00C12N1/20
Inventor陈少华何杰华范兴辉袁昊郭徨纯阳芳张炼辉
OwnerSOUTH CHINA AGRI UNIV