Method for producing alpha-ketoisovaleric acid with high yield

A ketoisovaleric acid and amino acid technology, applied in the field of bioengineering, can solve the problems such as no application report of L-amino acid oxidase, complicated separation and purification, residual intermediate products, etc., and is conducive to large-scale industrial production and product purity. High, mild conditions

Pending Publication Date: 2019-02-22
JIANGNAN UNIV +1
View PDF2 Cites 3 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0003] The production method of α-ketoisovaleric acid (α-KIV) includes chemical synthesis method and microbial method. The chemical synthesis method involves a series of chemical reaction processes with many and complicated steps, which is

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method for producing alpha-ketoisovaleric acid with high yield
  • Method for producing alpha-ketoisovaleric acid with high yield
  • Method for producing alpha-ketoisovaleric acid with high yield

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0036] Embodiment 1: Induced expression of recombinant genetically engineered bacteria

[0037] Construction process of recombinant bacteria:

[0038] (1) Using the genome of Corynebacterium glutamicum as a template, design primers for PCR to clone the gene encoding L-amino acid oxidase derived from Corynebacterium glutamicum. The primers used are: 5' ccgctcgagcggatgaaaattg cggtaatcgg 3' as forward primer , using 5'caagcttggataatgcacgtggcggagaaactaaccaagtac 3' as a reverse primer to amplify the target gene, the nucleotide sequence of which is shown in SEQ ID NO.2.

[0039] (2) Digest the target gene and the expression vector pET-28a with restriction endonucleases XhoI and hindIII at 37°C for 2h;

[0040] (3) Ligate the target gene and plasmid pET-28a after digestion and gel recovery with T4 ligase at 16°C for 10 h;

[0041] (4) Introduce the constructed expression plasmid into E.coli BL21(DE3), and culture it on the LB plate containing kanamycin for 12h;

[0042] (5) Perfor...

Embodiment 2

[0044] Example 2: Effect of conversion temperature on the production of α-ketoisovaleric acid

[0045] The wet thallus obtained in Example 1 was used as a catalyst for whole cell transformation. The specific transformation reaction conditions are: pH = 8.0, transformation temperature is 20°C, 25°C, 30°C, 37°C, substrate concentration is 65g / L, bacterial mass is 30g / L, transformation system is 20mL, transform at different temperatures After 24h, utilize HPLC to analyze the conversion product and the α-ketoisovalerate sodium standard substance that buys, as figure 1 As shown, it was proved that the conversion product was sodium α-ketoisovalerate. Adopt high performance liquid chromatography to measure the concentration situation of α-ketoisovaleric acid in the supernatant after the reaction (as figure 2 Shown), the result shows: when temperature is 20 ℃, ketovaline concentration is 46g / L. When the temperature is 25°C, the concentration of ketovaline is 51g / L. When the tempera...

Embodiment 3

[0046] Example 3: Effect of inversion pH on the production of α-ketoisovaleric acid

[0047] The wet thallus obtained in Example 1 was used as a catalyst for whole cell transformation. The specific transformation reaction conditions are: pH=7-9.5, transformation temperature is 25°C, substrate concentration is 65g / L, bacterial mass is 30g / L, transformation system is 20mL, after transformation for 24 hours, use high performance liquid chromatography to determine The concentration of α-ketoisovaleric acid in the supernatant after the reaction (as image 3 shown), the results showed that when the pH was 7.0, the concentration of α-ketoisovalerate was 45.3g / L; when the pH was 7.5, the concentration of α-ketoisovalerate was 47.6g / L; when the pH was At 8.0, the concentration of α-ketoisovalerate is 51g / L; when the pH is 8.5, the concentration of α-ketoisovalerate is 49.4g / L; when the pH is 9.0, the concentration of α-ketoisovalerate It is 46.1g / L. When the pH is 9.5, the concentra...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

No PUM Login to view more

Abstract

The invention discloses a method for producing alpha-ketoisovaleric acid with high yield, and belongs to the technical field of bioengineering. The method includes connecting a gene derived from Corynebacterium glutamicum encoded L-amino acid oxidase to an expression vector by a molecular biological means; introducing constructed expression plasmids into E. coli BL21 (DE3) and screening with a kanamycin-resistant plate to obtain a recombinant L-amino acid oxidase-containing engineered bacterium which is used for conversion of L-valine to produce alpha- ketoisovaleric acid. High-efficiency production of the alpha-ketoisovaleric acid is achieved by controlling temperature and pH and metal ions. The yield of the alpha-ketoisovaleric acid is up to 51 g/L with the conversion rate of 79.1% underthe condition that the temperature is 25 DEG C, pH=8.0, the biomass is 30 g/L, and the substrate concentration is 65 g/L.

Description

technical field [0001] The invention relates to a method for high-yielding α-ketoisovaleric acid, which belongs to the technical field of bioengineering. Background technique [0002] α-Ketoisovaleric acid (α-KIV), also known as ketovaline, is a branched chain keto acid with the molecular formula C 5 h 8 o 3 , the relative molecular mass is 116.12. α-Ketoisovaleric acid is an important intermediate, which is mainly used in food, medicine, cosmetics and other fields. Adding ketovaline to feed can promote muscle growth in livestock. α-keto acid has the effect of reducing renal filtration pressure and can be used to treat chronic uremia and nitrogen metabolism-related diseases. It is also an important raw material for vitamin B5. [0003] The production method of α-ketoisovaleric acid (α-KIV) includes chemical synthesis method and microbial method. The chemical synthesis method involves a series of chemical reaction processes with many and complicated steps, which is easy ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
IPC IPC(8): C12P7/40C12N1/21C12R1/19
CPCC12N9/0022C12P7/40C12Y104/03002
Inventor 吴静裴杉杉刘佳陈修来罗秋玲张权
Owner JIANGNAN UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap