Maize ipe1 mutant and its detection method and application
A protein mutant and corn technology, applied in the field of plant molecular biology, can solve the problems of reducing the purity of hybrids, economic losses, adverse effects of application, etc., and achieve excellent promotion and application potential, huge economic value, and rapid and accurate detection.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 2
[0057] Example 2 Identification of Fertility Mutant Floret Phenotype and Genetic Analysis
[0058] Observing the floret morphology of the 2805 mutant under a stereomicroscope, it was found that there was no significant difference between the pistil and the wild type, but the anthers of the mutant were smaller than the wild type (such as figure 1 As shown in A), the color is lighter (such as figure 1 shown in B). Collect florets at the flowering stage in the field, take out the anthers with tweezers, and put them in iodine-potassium iodide solution (0.6% KI, 0.3% I 2 , w / w), gently squeeze the anthers, drop them on a glass slide, cover with a cover glass, observe the pollen iodine staining under a microscope and take pictures. The wild type has a lot of pollen and is stained blue-black (such as figure 1 shown in C), while mutants cannot see pollen grains such as figure 1 as shown in D).
[0059] The 2805 mutant can bear fruit normally under open pollination, indicating tha...
Embodiment 3
[0060] Example 3 Obtaining and Sequence Analysis of IPE1 Gene Mutants
[0061] Through the amplification and sequence analysis of all maize fertility control genes, it was found that the gene mutation leading to the sporty traits of the 2805 mutation was an IPE1 gene mutant, and the amplification and sequence analysis methods of the IPE1 gene mutant were as follows.
[0062] 1. Extraction of maize genomic DNA
[0063] Adopt CTAB method to extract the genomic DNA of maize, concrete steps are as follows: get 3cm long maize leaf, in 800 μ L extraction buffer [1.5% (w / v) CTAB, 1.05mol / L NaCl, 75mmol / L Tris-HCl (pH 8.0), 15mmol / LEDTA (pH 8.0)] and collected into a 1.5mL centrifuge tube. Water bath at 65°C for 30 minutes, and mix by inverting occasionally. Add 800 μL of chloroform:isoamyl alcohol (volume ratio 24:1), and mix by inverting for 15 minutes. Centrifuge at 12000r / min for 10min at room temperature. Aspirate 450 μL of the supernatant, transfer to a new 1.5 mL centrifuge...
Embodiment 4
[0074] Example 4 Design of molecular markers and detection primers of IPE1 mutants and identification of genotype-phenotype co-segregation
[0075] 1. Design of molecular markers and detection primers for IPE1 mutants
[0076] According to the sequence design gene-specific primers on both sides of the mutation site of the IPE1 mutant obtained in Example 3, the sequence is as follows:
[0077] SEQ ID NO.10: forward primer 2805_F: CAGCTCCACGTTCAAGGACT;
[0078] SEQ ID NO. 11: Reverse primer 2805_R: ATCATTTCCTCCATCTCTCGG.
[0079] The above-mentioned amplification primers introduce a Hinf I restriction site at the mutation site, therefore, after the above-mentioned primers are amplified, Hinf I digestion can be used to identify the sequence type of the amplified product, specifically as follows: If the restriction product is long 91bp, the IPE1 genotype of the corn to be tested is the wild type; if the enzyme digestion product is 107bp long, the IPE1 genotype of the corn to be ...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More