Method for preparing chiral beta-amino alcohol by asymmetric amine hydrogxylation of olefin through cascade biocatalysis

A technology for biocatalyzing alkenes and aminoalcohols, applied in the biological field, can solve problems such as difficult to find with good activity and enantioselectivity, cofactor regeneration, etc., and achieve the effects of avoiding losses, saving costs, and high catalytic efficiency

Inactive Publication Date: 2019-08-27
TAIYUAN UNIV OF TECH
View PDF1 Cites 8 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Enzyme-catalyzed hydroxylation of asymmetric amines of alkenes to prepare chiral β -Aminoalcohols currently face many challenges, probably due to the difficulty in finding enzymes with good activity and enantioselectivity
In addition, solving the problem of cofactor regeneration in some cascade biocatalytic reactions still faces great challenges.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method for preparing chiral beta-amino alcohol by asymmetric amine hydrogxylation of olefin through cascade biocatalysis
  • Method for preparing chiral beta-amino alcohol by asymmetric amine hydrogxylation of olefin through cascade biocatalysis
  • Method for preparing chiral beta-amino alcohol by asymmetric amine hydrogxylation of olefin through cascade biocatalysis

Examples

Experimental program
Comparison scheme
Effect test

experiment example 1

[0045] Experimental Example 1: Construction of a recombinant expression vector:

[0046] SpEH gene upstream primer is CGC GGATCC GATGAAGTCGAACATATCCG, the downstream primer is CCC AAGCTT TCAAAGATCCATCTGTGCAAAGGC; primers were synthesized by Sangon Bioengineering (Shanghai) Co., Ltd., the underlined part is Bam H I and Hind III restriction site, and then use the plasmid pET28a-SpEH as a template to amplify the SpEH gene by PCR. The PCR amplification system was: 40 µL of sterilized distilled water, 5 µL of 10×Taq plus buffer, 1 µL of dNTPs, 1 µL of template, 1 µL of upstream primer, 1 µL of downstream primer, and 1 µL of Taq plus DNA polymerase. The PCR conditions are as follows: preheat the PCR instrument at 95° C. for 5 minutes to fully denature the template DNA, and then enter the amplification cycle. In each cycle, first keep at 94°C for 45 seconds to denature the template, then lower the temperature to the annealing temperature of 65°C and hold for 40 seconds to ful...

experiment example 2

[0048] Experimental example 2: Construction of co-expression vector

[0049] Ligate the gene SpEH into another polyclonal region of the recombinant plasmid pRSFDuet-SMO using restriction enzymes Ned I and xho I performed double enzyme digestion on the gene SpEH and the recombinant plasmid pRSFDuet-SMO, and the enzyme digestion conditions were the same as in Experimental Example 1. then use T 4 DNA ligase was used to connect the target gene SpEH and the expression vector pRSFDuet-SMO at 4 °C to construct the recombinant plasmid pRSFDuet-SMO-SpEH, which was introduced into E. coli DH5 by heat shock method α Competent cells were spread on LB solid medium plates containing kanamycin (50 μg / mL) and cultured overnight at 37 °C. After the colonies grow, randomly pick the single-clonal transformant on the resistant plate and put it in the LB liquid medium containing the corresponding antibiotic, culture it on a shaker at 37 ℃ for 12-16 h, extract the plasmid, and perform plasmid...

experiment example 3

[0051] Experimental example 3: Expression of Escherichia coli recombinant bacteria

[0052] For the expression of Escherichia coli recombinant bacteria, the following method is used in the present invention: inoculate the strain constructed in Experimental Example 1 into LB medium containing corresponding antibiotics (kanamycin or ampicillin), at 37°C, 200 rpm Shake culture for 8 hours, transfer 2% inoculum into a shake flask containing 45 mL of TB medium, add 5 mL of sterilized phosphate buffer; culture at 37 °C, 200 rpm, when the OD of the culture solution 600 When reaching 0.6, add IPTG with a final concentration of 0.1 mM, and induce for 12 h at 20 °C and 200 rpm. The cells were then collected by centrifugation at 8000 rpm for 5 min at 4 °C, and washed twice with 100 mM sodium phosphate buffer, pH 7.0. Suspend the obtained bacteria with 100 mM sodium phosphate buffer solution with a pH of 7.5, sonicate them in an ice bath, and collect the supernatant by centrifugation, wh...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention belongs to the technical field of biology, and provides a method for preparing chiral beta-amino alcohol by asymmetric amine hydroxylation of an olefin compound through cascade biocatalysis. Olefin monooxygenase, epoxide hydrolase, alcohol dehydrogenase and transaminase are taken as biocatalysts; olefin is used as a substrate and a reaction is performed in a phosphate buffer solutionto synthesize the chiral beta-amino alcohol. The conversion rate reaches up to 99% and the ee value is 97-99%. The olefin monooxygenase / alcohol dehydrogenase (ADH) / (R)-(+)-1 phenylethylamine (R-MBA)in a cascade biocatalytic system drives the reaction to be carried out towards a direction beneficial for product generation, and a cofactor NAD<+> is regenerated. The whole-cell cascade biocatalysisis realized through using engineering recombinant escherichia coli cells, and the chiral beta-amino alcohol is obtained. The method is used for converting the cheap olefin compound into various different chiral beta-amino alcohols; the catalytic efficiency is high, reaction conditions are mild, a reaction process is simple, the energy consumption is low, and the method is in line with the principle of green chemistry.

Description

technical field [0001] The invention belongs to the field of biotechnology, and in particular relates to a method for preparing chiral β-amino alcohols by cascade biocatalyzing the hydroxylation of asymmetric amines of alkenes. Background technique [0002] Chirality β -Amino alcohols are a very important class of chiral molecules, which are used as building blocks and intermediates in pharmaceutical active molecules and natural products, and are the main source of asymmetric synthesis of chiral compounds. For example,( S )-(+)-2-amino-1-butanol is an intermediate in the synthesis of an important anti-tuberculosis drug ethambutol (EMB); with ( S )-2-amino-2-phenylethanol as a building block, prepared indolin-2-one derivatives, which are inhibitors of P21-activated kinase (PAK4); ( S )-2-Amino-2-(4-bromophenyl)ethanol is an intermediate for the synthesis of 4,4`-bis(biphenyl)substituted bis(oxazoline)(BOX) ligands, and is a research in asymmetric catalysis One of the most...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12P13/00C12R1/19
CPCC12P13/001
Inventor张建栋杨晓晓赵剑伟常宏宏
OwnerTAIYUAN UNIV OF TECH