A method for regulating Torulopsis glabrata to resist low pH stress
A technology of Togus glabrata and genes, which is applied in the field of bioengineering and can solve problems affecting cell integrity, growth, and unclear specific mechanisms, etc.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0034] Example 1: Construction of deletion strain
[0035] Using the wild-type Candida glabrata ATCC 2001 genome as a template, using P1 / P2, P3 / P4, and P5 / P6 as primers to amplify the left arm (L) and histidine gene ( M) and the right arm (R), the knockout box CgRDS2-LMR ( figure 1 ). The knockout box with correct sequencing was introduced into the starting strain Candida glabrata HTUΔ (the genotype is his3Δtrp1Δura3Δ, which was described in Yan DN, Lin XB, Qi YL, LiuH, Chen XL, Liu LM, Chen J. 2016. Crz1p regulates pH homeostasis in Candidaglabrata by altering membrane lipid composition.Appl Environ Microb 82:6920-6929. Published in the paper, publication date: 2016-12-31), using histidine marker gene to screen positive transformants, and extract the genome PCR sequencing verification . The strain verified to be correct is the deletion strain Cgrds2Δ.
[0036] P1: ATTCGAAGGCCCACTGTA
[0037] P2: ACCCTCTTAACAAACGCCATGTCAAAAATATGATGCTGTGCTTAG
[0038] P3: CACAGCATCATATTTTTGACATGGC...
Embodiment 2
[0042] Example 2: Construction of overexpression strain
[0043] The wild-type Candida glabrata ATCC 2001 genome was used as a template, and the target gene CgRDS2 (gene ID: 2891470) was amplified using P7 / P8 as primers. The amplified product and plasmid pY26 were used with the same restriction enzymes NotI and After digestion with BglII, the gene CgRDS2 was ligated with plasmid pY26 by T4 ligase. Plasmid pY26 is a two-way expression plasmid containing two promoters, TEF and GPD. The gene CgRDS2 was ligated to the back of the TEF promoter on plasmid pY26, and the plasmid pY26 TEF Start transcription, use the URA3 gene on the recombinant plasmid to screen positive transformants, and finally extract the plasmid to verify that the overexpression strain Cgrds2Δ / CgRDS2( figure 2 ).
[0044] P7: AAGGAAAAAAGCGGCCGCATGGAAGAACCAGCAGC
[0045] P8: GGAAAGATCTTTAGTTGGAATGATCTCTTGTAGGA
Embodiment 3
[0046] Example 3: Determination of the growth performance of each strain
[0047] (1) Plate growth experiment: Inoculate a single colony of the tested strain in 20 mL of YNB (0.67% YeastNitrogen Base without Amino Acids, 2% Glucose) liquid medium for overnight activation, and then transfer to YNB medium to cultivate until the Several phases, determine the concentration of bacteria and adjust the suspension to OD 660 =1.0, using this as the initial concentration, perform 5 times of 10-fold gradient dilution, sequentially spot 4μL of bacterial liquid on the corresponding solid YNB medium, cultivate at 30°C for 2-3 days, observe the growth of the bacterial cells and take pictures ( image 3 ).
[0048] (2) Growth curve testability: inoculate a single colony of the tested strain in 20mL YNB (0.67% YeastNitrogen Base without Amino Acids, 2% Glucose) liquid medium for overnight activation, and then transfer to 100mL YNB or pH 2.0 YNB liquid medium, control the initial OD 660 =0.1, 30℃, 2...
PUM
Abstract
Description
Claims
Application Information
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap