Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

A method for regulating Torulopsis glabrata to resist low pH stress

A technology of Togus glabrata and genes, which is applied in the field of bioengineering and can solve problems affecting cell integrity, growth, and unclear specific mechanisms, etc.

Active Publication Date: 2020-09-04
JIANGNAN UNIV
View PDF3 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

At the same time, due to the current research on transcription factors in Toruula glabrata is very limited, the specific mechanism of its regulation of microorganisms to resist external environmental stress is not very clear, when the transcription factors are deleted or overexpressed, it may affect the integrity of the cells affect its growth under normal conditions

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • A method for regulating Torulopsis glabrata to resist low pH stress
  • A method for regulating Torulopsis glabrata to resist low pH stress
  • A method for regulating Torulopsis glabrata to resist low pH stress

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0034] Example 1: Construction of deletion strain

[0035] Using the wild-type Candida glabrata ATCC 2001 genome as a template, using P1 / P2, P3 / P4, and P5 / P6 as primers to amplify the left arm (L) and histidine gene ( M) and the right arm (R), the knockout box CgRDS2-LMR ( figure 1 ). The knockout box with correct sequencing was introduced into the starting strain Candida glabrata HTUΔ (the genotype is his3Δtrp1Δura3Δ, which was described in Yan DN, Lin XB, Qi YL, LiuH, Chen XL, Liu LM, Chen J. 2016. Crz1p regulates pH homeostasis in Candidaglabrata by altering membrane lipid composition.Appl Environ Microb 82:6920-6929. Published in the paper, publication date: 2016-12-31), using histidine marker gene to screen positive transformants, and extract the genome PCR sequencing verification . The strain verified to be correct is the deletion strain Cgrds2Δ.

[0036] P1: ATTCGAAGGCCCACTGTA

[0037] P2: ACCCTCTTAACAAACGCCATGTCAAAAATATGATGCTGTGCTTAG

[0038] P3: CACAGCATCATATTTTTGACATGGC...

Embodiment 2

[0042] Example 2: Construction of overexpression strain

[0043] The wild-type Candida glabrata ATCC 2001 genome was used as a template, and the target gene CgRDS2 (gene ID: 2891470) was amplified using P7 / P8 as primers. The amplified product and plasmid pY26 were used with the same restriction enzymes NotI and After digestion with BglII, the gene CgRDS2 was ligated with plasmid pY26 by T4 ligase. Plasmid pY26 is a two-way expression plasmid containing two promoters, TEF and GPD. The gene CgRDS2 was ligated to the back of the TEF promoter on plasmid pY26, and the plasmid pY26 TEF Start transcription, use the URA3 gene on the recombinant plasmid to screen positive transformants, and finally extract the plasmid to verify that the overexpression strain Cgrds2Δ / CgRDS2( figure 2 ).

[0044] P7: AAGGAAAAAAGCGGCCGCATGGAAGAACCAGCAGC

[0045] P8: GGAAAGATCTTTAGTTGGAATGATCTCTTGTAGGA

Embodiment 3

[0046] Example 3: Determination of the growth performance of each strain

[0047] (1) Plate growth experiment: Inoculate a single colony of the tested strain in 20 mL of YNB (0.67% YeastNitrogen Base without Amino Acids, 2% Glucose) liquid medium for overnight activation, and then transfer to YNB medium to cultivate until the Several phases, determine the concentration of bacteria and adjust the suspension to OD 660 =1.0, using this as the initial concentration, perform 5 times of 10-fold gradient dilution, sequentially spot 4μL of bacterial liquid on the corresponding solid YNB medium, cultivate at 30°C for 2-3 days, observe the growth of the bacterial cells and take pictures ( image 3 ).

[0048] (2) Growth curve testability: inoculate a single colony of the tested strain in 20mL YNB (0.67% YeastNitrogen Base without Amino Acids, 2% Glucose) liquid medium for overnight activation, and then transfer to 100mL YNB or pH 2.0 YNB liquid medium, control the initial OD 660 =0.1, 30℃, 2...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a method for regulating resistance of torulopsis glabrata against low pH stress, and belongs to the technical field of bioengineering. The present invention regulates resistance of torulopsis glabrata against low pH stress by deleting or overexpressing an encoding gene CgRDS2 of an original transcription factor. The result shows that the torulopsis glabrata can reduce cellconcentration by 32.6%, cell viability by 56.9%, intracellular ATP content by 33.5% and cell membrane permeability by 23.6% under condition of low pH stress compared to an original strain after deleting CgRDS2; and the torulopsis glabrata keeps cell concentration unchanged substantially, and improves cell viability by 17.6%, intracellular ATP content by 41.5% and cell membrane permeability by 18.8% under condition of low pH stress compared to the original strain after overexpressing CgRDS2.

Description

Technical field [0001] The present invention relates to a method for regulating S. glabrata to resist low pH stress, and belongs to the technical field of bioengineering. Background technique [0002] As the only industrial microorganism producing pyruvate, Saccharomyces glabrata is also used to produce other organic acids, such as malic acid, fumaric acid, and α-ketoglutarate. In the process of fermentation and production of organic acids, the accumulation of extracellular organic acids will cause the pH of the medium to drop, severely inhibit cell growth, and reduce the output of organic acids. Therefore, effectively solving the low pH stress is an urgent problem in the process of fermentation production of organic acids by S. glabrata. The current solution to low pH stress is mainly to add NaOH and CaCO to the fermentation medium 3 Such as alkaline substances, but the addition of these substances will cause the osmotic pressure of the fermentation system to continue to rise, ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12N1/19C12P7/40C12P7/46C12P7/50C12R1/645
CPCC07K14/39C12P7/40C12P7/46C12P7/50
Inventor 刘立明吴承晋陈修来刘佳罗秋玲
Owner JIANGNAN UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com