A method for synthesizing p-hydroxymandelic acid

A technology for p-hydroxymandelic acid and p-hydroxybenzaldehyde, applied in the field of bioengineering, can solve the problems of high cost, environmental pollution, equipment corrosion, expensive substrates, etc., and achieves the effects of easy operation, efficient production, and cost reduction

A technology for p-hydroxymandelic acid and p-hydroxybenzaldehyde, applied in the field of bioengineering, can solve the problems of high cost, environmental pollution, equipment corrosion, expensive substrates, etc., and achieves the effects of easy operation, efficient production, and cost reduction

CN110982771BActive Publication Date: 2021-05-28JIANGNAN UNIV

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • A method for synthesizing p-hydroxymandelic acid
  • A method for synthesizing p-hydroxymandelic acid
  • A method for synthesizing p-hydroxymandelic acid

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0043] Example 1: Construction of recombinant plasmid pRSFDuet-pdc

[0044] The artificially synthesized pdc gene (nucleotide sequence shown in SEQ ID NO: 1) containing BamHI and SalI restriction sites through codon optimization, pdc gene and plasmid pRSFDuet- with restriction endonuclease BamHI and SalI 1 Digest for 3 hours at 37°C, use T 4 Ligase ligated the pdc gene and plasmid pRSFDuet-1 after digestion and gel recovery at 16°C for 10 h, and transformed the ligated product into E.coli JM109 competent cells by chemical transformation method, and cultured it on LB plates containing ampicillin for 12 h. Colonies grown on the plate were verified by PCR. Positive transformants were selected and inoculated in LB medium, cultured at 37°C for 12 hours, and plasmids were extracted. After sequencing verification, the recombinant plasmid pRSFDuet-pdc was constructed.

Embodiment 2

[0045] Embodiment 2: Construction of recombinant plasmid pETDuet-padA

[0046] Using the genome of Escherichia coli MG1655 as a template, the 5'CG GGATCC AATGACAGAGCCGCATGTA 3' as forward primer, 5' as ACGC GTC GAC TTAATACCGTACACACACCGA 3' is the reverse primer (the underlined part is respectively the restriction site of BamHI and SalI) amplifying and obtaining the padA gene (nucleotide sequence shown in SEQ ID NO: 2), using restriction endonucleases BamHI and SalI digested the padA gene and the plasmid pETDuet-padA at 37°C for 3h, and used T 4 Ligase ligated the padA gene and plasmid pETDuet-1 after enzyme digestion and gel recovery for 10 hours at 16°C, and transformed the ligation product into E.coli JM109 competent cells by chemical transformation method, and cultured it on an LB plate containing ampicillin for 12 hours. Colonies grown on the plate were verified by PCR. Positive transformants were selected and inoculated in LB medium, cultured at 37°C for 12 hours, an...

Embodiment 3

[0047] Example 3: Construction of recombinant plasmid pETDuet-padA-noxE

[0048] Using the genome of Bacillus subtilis 168 as a template, the 5'GGA AGATCT AATGACGAATACTCTGGATGTTT3' as forward primer, with 5' CCG CTCGAG TTACAGCCAAGTTGATACTTTT 3' is the reverse primer (the underlined part is the restriction site of BglII and XhoI respectively) to amplify the noxE gene (nucleotide sequence shown in SEQ ID NO: 3), and use restriction enzymes BglII and XhoⅠdigested the noxE gene and plasmid pETDuet-padA at 37°C for 3h, and used T 4 The noxE gene and plasmid pETDuet-padA after digestion and gel recovery were ligated with ligase for 10 hours at 16°C, and the ligated products were transformed into E.coli JM109 competent cells by chemical transformation, and cultured on LB plates containing kanamycin for 12 hours , and verify the colonies grown on the plate by PCR. Positive transformants were selected and inoculated in LB medium, cultured at 37°C for 12 hours, and plasmids were ex...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a method for synthesizing p-hydroxymandelic acid, which belongs to the technical field of bioengineering. The present invention constructs a dual-plasmid recombinant bacterium by means of molecular biology, co-expresses pyruvate decarboxylase, phenylacetaldehyde dehydrogenase and NADH oxidase genes, and introduces the constructed expression plasmid into E. coli BL21 (DE3). Convert p-hydroxybenzaldehyde and glyoxylate to p-hydroxymandelic acid, and through the NADH oxidase coenzyme regeneration system, by converting NADH to NAD + , making NAD + Recycling, conversion can be carried out efficiently. And by optimizing the substrate concentration and ratio, optimizing the conversion temperature and pH, the efficient production of p-hydroxymandelic acid was realized. Under the conditions of 30° C. and pH 7 for 24 hours, 30 mM of the substrate p-hydroxybenzaldehyde can be converted into 28.5 mM of p-hydroxymandelic acid, and the conversion rate can reach 95%.

Description

technical field [0001] The invention relates to a method for synthesizing p-hydroxymandelic acid, belonging to the technical field of bioengineering. Background technique [0002] p-Hydroxymandelic acid, also known as 4-hydroxymandelic acid, molecular formula C 8 h 8 o 4 , English name 4-Hydroxyphenylglycolic acid, alias 2-Hydroxy-2-(4-hydroxyphenyl) acetic acid. Appearance is light yellow hydrate solid, melting point 109.5-110.5°C (anhydrous). [0003] P-hydroxymandelic acid is an important intermediate of medicine, pesticide and fragrance. Especially in medicine, p-hydroxymandelic acid is an intermediate for preparing the new antihypertensive drug Atenolol (Ateno), and is also an intermediate for preparing the new broad-spectrum antibiotic drug amoxicillin. P-hydroxymandelic acid is clinically used to treat neck pain, headache, migraine, dizziness, coronary heart disease, angina pectoris and early neurosensory deafness caused by high blood pressure. Synthesis of tiro...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
28 May 2021
Publication
CN110982771B
IPC
C12N1/21; C12P7/42; C12R1/19
CPC
C12N9/0008; C12N9/88; C12P7/42; C12Y102/01039; C12Y401/01001
Inventors
刘立明; 王蕾