Nucleic-acid composite nano-drug self-assembled and constructed based on coordination of metal ions, and preparation method and application of nucleic-acid composite nano-drug

A technology of metal ions and nano-drugs, applied in the field of nucleic acid nanotechnology and biomedicine, can solve the problems of complex synthesis steps and obstacles to wide application, and achieve the effects of simple preparation process, wide application range and high drug loading rate

Active Publication Date: 2020-06-23
SHANGHAI JIAO TONG UNIV
View PDF11 Cites 8 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, these methods are complicated both in the early design and later synthesis steps, which hinders their wide application in the biomedical field.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Nucleic-acid composite nano-drug self-assembled and constructed based on coordination of metal ions, and preparation method and application of nucleic-acid composite nano-drug
  • Nucleic-acid composite nano-drug self-assembled and constructed based on coordination of metal ions, and preparation method and application of nucleic-acid composite nano-drug
  • Nucleic-acid composite nano-drug self-assembled and constructed based on coordination of metal ions, and preparation method and application of nucleic-acid composite nano-drug

Examples

Experimental program
Comparison scheme
Effect test

preparation example Construction

[0060] The preparation method of constructing nucleic acid composite nanomedicine based on metal ion coordination self-assembly of the present invention comprises the following steps:

[0061] (1), metal salt is dissolved in solvent, obtains metal ion solution;

[0062] (2) Dissolving the nucleic acid in a solvent, or in a solution containing a loaded drug or a solution containing a fluorescent probe, to obtain a first mixed solution;

[0063] (3), adding the metal ion solution into the first mixed solution, and vortexing to obtain the second mixed solution;

[0064] (4) Stir the second mixed solution and centrifuge to obtain a nucleic acid composite nanomedicine based on ion-coordinated self-assembly.

[0065] Wherein, the nucleic acid is selected from more than one of any unmodified nucleic acid sequence, any modified nucleic acid sequence, or a conjugate of a chemotherapeutic drug and DNA, including but not limited to a mixture of any unmodified nucleic acid sequence and a...

Embodiment 1

[0103] The preparation method of constructing nucleic acid composite nanomedicine based on iron ion coordination self-assembly in this embodiment comprises the following steps:

[0104] (1), 1.988mg ferrous chloride tetrahydrate is dissolved in 1mL water (concentration is 10mmol / L), obtains ferrous chloride solution;

[0105] (2) Dissolving random sequence DNA (sequence: ATCGTCGATGCTAATCCTGA SEQ ID NO.1) in water to prepare a 25 μmol / L aqueous solution to obtain a DNA solution;

[0106] (3) Then use a pipette to take 20 μL of ferrous chloride solution and add it to the DNA solution containing 180 μL, then vortex for 10 seconds, put it in a metal bath at 95°C, centrifuge at 13000 rpm for 10 minutes after 2 hours, and collect the precipitate. Add 100 μL of deionized water and shake to dissolve to obtain DNA nanocarriers (DNA-Fe NPs), then draw the above solution to prepare TEM samples for observation, see figure 1 . The TEM image shows that the DNA nanoparticles prepared by th...

Embodiment 2

[0108] The DNA composite nanomedicine prepared in this example is not exactly the same as the preparation method in Example 1, and the DNA composite nanomedicine can be synthesized by changing the synthesis temperature, and the specific steps are the same as in Example 1:

[0109] (1), 1.988mg ferrous chloride tetrahydrate is dissolved in 1mL water (concentration is 10mmol / L), obtains ferrous chloride solution;

[0110] (2) Dissolving palindromic sequence DNA (sequence: AACGTTAACGTTTGGGAATTCCCAATCGACGTCGAT SEQ ID NO.2) in water to prepare a 25 μmol / L aqueous solution to obtain a DNA solution;

[0111] (3) Then use a pipette to take 20 μL of ferrous chloride solution and add it to the DNA solution containing 180 μL, then vortex for 10 seconds, put them into metal baths at different temperatures of 25°C, 60°C, and 95°C for 2 hours Then centrifuge at 13000rpm for 10min, collect the precipitate, add 100μL of deionized water and shake to dissolve, then prepare TEM sample, observe, ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
particle sizeaaaaaaaaaa
particle diameteraaaaaaaaaa
Login to View More

Abstract

The invention provides a nucleic-acid composite nano-drug self-assembled and constructed based on coordination of metal ions, and a preparation method and application of the nucleic-acid composite nano-drug. The nucleic-acid composite nano-drug can be applied to drugs for treating skin; the nucleic-acid composite nano-drug is formed through driving a nucleic acid nano-material with relatively goodbiocompatibility to assemble a nucleic acid nano-carrier with uniform size and controllable particle size and loading a drug based on the coordination of the metal ions; or the nucleic-acid compositenano-drug is formed through driving assembling of a conjugate of a chemotherapy drug and nucleic acid; or the nucleic-acid composite nano-drug is formed through driving a gene drug or a gene drug ofan embedded drug. According to the method provided by the invention, the complexity of a design and synthesis process of a nucleic acid nano-material by a nucleic acid nanotechnology is improved, thebiotoxicity of the nano-material is effectively lowered, the hydrophobic problem of the drug can be solved, and the treatment effect of the drug is improved; and in addition, the nano-composite nano-system has relatively good skin tissue permeability and provides a novel way of think for the field of local drug administration.

Description

technical field [0001] The invention belongs to the field of nucleic acid nanotechnology and biomedicine, and in particular relates to a nucleic acid composite nanomedicine based on metal ion coordination self-assembly and its preparation method and application. Background technique [0002] Hypertrophic scar (HS) is a disorder of fibroblast proliferation in the skin dermis, resulting in excessive production of fibroblasts and excessive deposition of collagen. It is a common complication after trauma, especially after burns. Wound fibroblasts produce new extracellular matrix proteins, including collagen type I, type III, fibronectin, proteoglycan, and ultimately tissue remodeling and scar formation. The etiology and pathogenesis of HS are still not completely clear, and there are many treatment methods. At present, surgery and drug treatment are the main clinical treatment methods, but there are some problems, such as high recurrence rate, so a new drug treatment method is u...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): A61K47/69A61K47/52A61K47/54A61K49/00A61K48/00A61K45/00A61P17/00A61P17/02A61P17/06B82Y5/00B82Y30/00B82Y40/00
CPCA61K47/6929A61K47/52B82Y5/00B82Y30/00B82Y40/00A61K31/513A61K31/7068A61K47/549A61K48/0008A61P17/02A61P17/00A61P17/06A61K49/0093A61K49/0052A61K45/00
Inventor宋杰江凯陈云生
OwnerSHANGHAI JIAO TONG UNIV