Nucleic-acid composite nano-drug self-assembled and constructed based on coordination of metal ions, and preparation method and application of nucleic-acid composite nano-drug
A technology of metal ions and nano-drugs, applied in the field of nucleic acid nanotechnology and biomedicine, can solve the problems of complex synthesis steps and obstacles to wide application, and achieve the effects of simple preparation process, wide application range and high drug loading rate
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
preparation example Construction
[0060] The preparation method of constructing nucleic acid composite nanomedicine based on metal ion coordination self-assembly of the present invention comprises the following steps:
[0061] (1), metal salt is dissolved in solvent, obtains metal ion solution;
[0062] (2) Dissolving the nucleic acid in a solvent, or in a solution containing a loaded drug or a solution containing a fluorescent probe, to obtain a first mixed solution;
[0063] (3), adding the metal ion solution into the first mixed solution, and vortexing to obtain the second mixed solution;
[0064] (4) Stir the second mixed solution and centrifuge to obtain a nucleic acid composite nanomedicine based on ion-coordinated self-assembly.
[0065] Wherein, the nucleic acid is selected from more than one of any unmodified nucleic acid sequence, any modified nucleic acid sequence, or a conjugate of a chemotherapeutic drug and DNA, including but not limited to a mixture of any unmodified nucleic acid sequence and a...
Embodiment 1
[0103] The preparation method of constructing nucleic acid composite nanomedicine based on iron ion coordination self-assembly in this embodiment comprises the following steps:
[0104] (1), 1.988mg ferrous chloride tetrahydrate is dissolved in 1mL water (concentration is 10mmol / L), obtains ferrous chloride solution;
[0105] (2) Dissolving random sequence DNA (sequence: ATCGTCGATGCTAATCCTGA SEQ ID NO.1) in water to prepare a 25 μmol / L aqueous solution to obtain a DNA solution;
[0106] (3) Then use a pipette to take 20 μL of ferrous chloride solution and add it to the DNA solution containing 180 μL, then vortex for 10 seconds, put it in a metal bath at 95°C, centrifuge at 13000 rpm for 10 minutes after 2 hours, and collect the precipitate. Add 100 μL of deionized water and shake to dissolve to obtain DNA nanocarriers (DNA-Fe NPs), then draw the above solution to prepare TEM samples for observation, see figure 1 . The TEM image shows that the DNA nanoparticles prepared by th...
Embodiment 2
[0108] The DNA composite nanomedicine prepared in this example is not exactly the same as the preparation method in Example 1, and the DNA composite nanomedicine can be synthesized by changing the synthesis temperature, and the specific steps are the same as in Example 1:
[0109] (1), 1.988mg ferrous chloride tetrahydrate is dissolved in 1mL water (concentration is 10mmol / L), obtains ferrous chloride solution;
[0110] (2) Dissolving palindromic sequence DNA (sequence: AACGTTAACGTTTGGGAATTCCCAATCGACGTCGAT SEQ ID NO.2) in water to prepare a 25 μmol / L aqueous solution to obtain a DNA solution;
[0111] (3) Then use a pipette to take 20 μL of ferrous chloride solution and add it to the DNA solution containing 180 μL, then vortex for 10 seconds, put them into metal baths at different temperatures of 25°C, 60°C, and 95°C for 2 hours Then centrifuge at 13000rpm for 10min, collect the precipitate, add 100μL of deionized water and shake to dissolve, then prepare TEM sample, observe, ...
PUM
Property | Measurement | Unit |
---|---|---|
particle size | aaaaa | aaaaa |
particle diameter | aaaaa | aaaaa |
Abstract
Description
Claims
Application Information
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap