A method for preparing raspberry ketone by whole cell transformation

A technology of whole cell transformation and raspberry ketone, which is applied in the field of genetic engineering, can solve problems such as complex preparation methods, long fermentation time, and equipment corrosion, and achieve the effects of environmental protection, high conversion efficiency, and low energy consumption in the preparation process

Active Publication Date: 2022-05-17
JIANGNAN UNIV
View PDF0 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0004] Among them, there are many chemical synthesis paths of raspberry ketone, but there are mainly three kinds in production: Albertus et al. use methyl vinyl ketone and phenol as raw materials and strong acid as a catalyst to synthesize raspberry ketone, and then extract, distill, and regenerate After operations such as crystallization, the finished product of raspberry ketone is obtained, and the yield is about 69%. However, the preparation method of the raw material methyl vinyl ketone used in the synthesis process is particularly complicated and highly toxic, and has not been widely promoted; Butanol ketone is used as a raw material, and the alkylation reaction is carried out under acid catalysis to generate raspberry ketone. Butanol ketone can be used to replace toxic methyl vinyl ketone, but butanol ketone is easy to lose water during the reaction to generate methyl vinyl ketone. Accompanied by the generation of other by-products, and this reaction also requires strong acid and low temperature conditions, and there are also problems such as environmental pollution and equipment corrosion; the Claisen-Schmidt condensation method uses p-hydroxybenzaldehyde and acetone to condense and then hydrogenate The reduction reaction generates raspberry ketone. This method has high yield and good product quality, but it will also cause problems such as equipment corrosion and environmental pollution.
[0005] The biological synthesis of raspberry ketone is still in the laboratory stage; in 1998, Fuganti et al. used 14 different microorganisms to reduce p-hydroxybenzylidene acetone, and the production of raspberry ketone could be detected (Journal of Molecular Catalysis B Enzymatic, 1998); In 2007, Beekwilder et al. further introduced p-coumaric acid from tobacco based on the activity of benzylacetone reductase in E. coli: CoA ligase and chalcone synthase from raspberry were expressed in E. coli and yeast expression systems In Escherichia coli, raspberry ketone only reached a yield of 5 mg / L (Biochemical Journal, 2006); in 2019, Wang Chengcheng et al overexpressed a plant-derived 4-coumaroyl-CoA ligase, The three genes of benzylacetone synthase and benzylacetone reductase, by adding p-coumaric acid to the fermentation medium, only obtained a yield of 178 mg / L raspberry ketone (Applied Microbiology and Biotechnology, 2019); it can be seen that the above The concentration of raspberry ketone produced by fermentation is generally not high, and the fermentation time is long; the expression of various heterologous proteins increases the metabolic burden of Escherichia coli, and the precursor substrates and metabolic intermediates are toxic to cells. It is beneficial to the growth of bacteria and the transformation of precursor substrates, but it cannot meet the production requirements

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • A method for preparing raspberry ketone by whole cell transformation
  • A method for preparing raspberry ketone by whole cell transformation
  • A method for preparing raspberry ketone by whole cell transformation

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0058] Embodiment 1: Construction of the recombinant plasmid containing glucose dehydrogenase gene sygdh

[0059] Specific steps are as follows:

[0060] Using the codon-optimized nucleotide sequence such as the glucose dehydrogenase gene sygdh shown in SEQ ID NO.2 as a template, PCR amplification was performed with sygdh-F and sygdh-R as primers; the PCR reaction conditions were: 90 Pre-denaturation at -95°C for 3 to 5 minutes, denaturation at 94°C for 30 to 45 seconds, annealing at 55°C for 30 to 45 seconds, extension at 70 to 72°C for 1 minute, 30 cycles, and full extension at 70 to 72°C for 5 to 10 minutes.

[0061] After the PCR reaction, the PCR product was detected by agarose gel electrophoresis, and the glucose dehydrogenase gene sygdh was recovered by cutting the gel. The primers are:

[0062] sygdh-F: GGATCCATGACCGAACAGAAAG (SEQ ID NO. 3)

[0063] sygdh-R: AAGCTTGCGGCCGCTTACTGC (SEQ ID NO. 4)

[0064] Ligate the glucose dehydrogenase gene sygdh obtained in the ab...

Embodiment 2

[0065] Example 2: Construction of recombinant plasmids containing glucose dehydrogenase gene sygdh and benzylacetone reductase gene rirzs1

[0066] Specific steps are as follows:

[0067] The benzylacetone reductase gene rirzs1 whose codon-optimized nucleotide sequence is shown in SEQ ID NO.1 was used as a template, and rirzs1-F and rirzs1-R were used as primers for PCR amplification; the PCR reaction conditions were: Pre-denaturation at 90-95°C for 3-5min, denaturation at 94°C for 30-45sec, annealing at 55°C for 30-45sec, extension at 70-72°C for 1min, 30 cycles, full extension at 70-72°C for 5-10min.

[0068] After the PCR reaction, the PCR product was detected by agarose gel electrophoresis, and the benzylacetone reductase gene rirzs1 was recovered by cutting the gel. The primers are:

[0069] rirzs1-F: AGATCTATGGCCAGCGGC (SEQ ID NO. 5)

[0070] rirzs1-R: GGTACCTTATTCACGGCTAACCA (SEQ ID NO. 6)

[0071] The benzyl acetone reductase gene rirzs1 obtained in the above steps...

Embodiment 3

[0072] Example 3: Construction of recombinant Escherichia coli co-expressing benzyl acetone reductase and glucose dehydrogenase

[0073] Specific steps are as follows:

[0074] (1) The recombinant plasmid pET-sygdh-rirzs1 constructed in Example 2, pACYC-sygdh-rirzs1, pCDF-sygdh-rirzs1 and pRSF-sygdh-rirzs1 were transformed into Escherichia coli BL21 (DE3) competent cells respectively to obtain Single plasmid recombinant engineering strains BL21 / pET-sygdh-rirzs1, BL21 / pACYC-sygdh-rirzs1, BL21 / pCDF-sygdh-rirzs1 and BL21 / pRSF-sygdh-rirzs1.

[0075] (2) Construction of recombinant engineering strains containing dual plasmid expression vectors pET20b(+)-rirzs1 and pET28a(+)-sygdh

[0076] With codon optimized nucleotide sequence such as glucose dehydrogenase gene sygdh shown in SEQ ID NO.2 and codon optimized nucleotide sequence such as the benzyl acetone reduction shown in SEQ ID NO.1 The enzyme gene rirzs1 is used as a template, and sygdh-F-Nco I, sygdh-R-Xho I, rirzs1-F-Nde I,...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
concentrationaaaaaaaaaa
Login to View More

Abstract

The invention discloses a method for preparing raspberry ketone by transforming whole cells, belonging to the technical field of genetic engineering. In the present invention, the recombinant engineered bacteria co-expressing benzyl acetone reductase and glucose dehydrogenase genes are used as biocatalysts, p-hydroxybenzylidene acetone is used as a substrate, and the whole cells of microorganisms with permeability are synthesized from the circulating NADPH donor system. Raspberry ketone, in a 50mL system, react at 45°C for 1 hour, the concentration of raspberry ketone can be as high as 9.4g L ‑1 . The invention overcomes the defects of high pollution of chemical synthesis, low yield and low production efficiency of non-biological sources and biological fermentation method, and provides a method for efficiently synthesizing raspberry ketone by biological method.

Description

technical field [0001] The invention relates to a method for preparing raspberry ketone by transforming whole cells, belonging to the technical field of genetic engineering. Background technique [0002] Raspberry ketone was first extracted from raspberry fruit. It is the main aroma component of raspberry fruit. Production is less and expensive, about $3,000 per kilogram. Raspberry ketone, which is commonly used in the market, is synthesized from fossil fuels p-hydroxybenzaldehyde and acetone. Nowadays, in the fragrance industry, raspberry ketone has become a kind of fragrance with extremely high economic value, and it is second only to vanillin. Because of its unique fruity aroma, raspberry ketone is widely used in food flavors, cosmetics, insect attractants, and medicine. Acetate of raspberry ketone (4-p-acetoxyphenyl-2-butanone, CeuLure), known as muscarin, is an insect attractant that plays a huge role in the detection and control of melon flies ( Florida Entomologis...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityPatents(China)
IPC IPC(8): C12N1/21C12N15/70C12N15/53C12P7/26C12R1/19
CPCC12N9/0006C12N15/70C12P7/26C12Y101/01049
Inventor郑璞杨波吴丹陈鹏程
OwnerJIANGNAN UNIV