Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Genetically engineered bacterium for producing muconic acid by taking lignin as raw material

A technology of genetically engineered bacteria and lignin, applied in the field of genetic engineering, can solve the problem that mucofuroic acid cannot be accumulated, and achieve the effect of realizing high-value utilization and expanding the substrate spectrum.

Pending Publication Date: 2021-02-02
NANJING UNIV OF SCI & TECH
View PDF0 Cites 1 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, in the process of microbial degradation of lignin, mucofuroic acid generated will be quickly catalyzed by related enzymes for subsequent reactions, so mucofuroic acid can hardly accumulate

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Genetically engineered bacterium for producing muconic acid by taking lignin as raw material
  • Genetically engineered bacterium for producing muconic acid by taking lignin as raw material
  • Genetically engineered bacterium for producing muconic acid by taking lignin as raw material

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0029] (1) Construction of suicide plasmid backbone pk18mob-pheS

[0030]Extract the Rhodococcus opacus PD630 genome, and design specific primers to clone the nucleotide fragment comprising the phenylalanyl-tRNA synthetase gene (AHK32253.1) and its own promoter, wherein the upstream primer is SEQ ID NO: 1: TACCCGGGGATCCTCTAGATGCGGTCCTCGACAGCATCAGCG; the downstream primer is SEQ ID NO: 2: AACGACGGCCAGTGCCAAGCTTATTGCGCTACTCGCACGTCTGC according to the following system for PCR reaction:

[0031] 5×Reaction buffer 10.0 μL dNTPs (10mM) 1.0 μL Upstream primer SEQ ID NO:1 (10μM) 1.0 μL Downstream primer SEQ ID NO:2 (10μM) 1.0 μL Rhodococcus opacus PD630 genome 1.0 μL Taq enzyme (5U / μL) 1.0 μL wxya 2 o

35.0μL overall system 50μL

[0032] The reaction system was carried out according to the following procedure: pre-denaturation at 95°C for 3 min; denaturation at 95°C for 30 s, annealing at 55°C for 30 s, extension at 7...

Embodiment 2

[0053]Embodiment 2 takes commercially available lignin as substrate transformation and produces viscous furoic acid

[0054] Add 10mM glucose in the M9 medium as the fermentation medium, convert mucofuroic acid with commercially available lignin at a concentration of 1, 2, and 5g / L during fermentation, and inoculate the R.opacus PD630-MA4 strain, such as Figure 4 As shown, the fermentation results showed that the maximum yield of mucofuroic acid was 0.023, 0.040, 0.078g / L respectively within 96h.

Embodiment 3

[0055] Example 3 Transform mucofuroic acid with the lignin of acid+alkali joint treatment as substrate

[0056] 1. The lignin treatment steps are: (1) 50g of corn stalks are added into 500mL of 1% sulfuric acid solution, treated with an autoclave at 120°C for 30min, and then the liquid is extracted with a vacuum filter pump; (2) ) Measure the dry weight of the remaining solids, add the dry matter to the total mass ratio of 1:10 into the NaOH solution with a mass fraction of 1%, and then use an autoclave to treat it at 120°C for 60min; (3) after collection and treatment The liquid was sterilized at 121°C for 15min and used as a substrate for engineering bacteria to ferment mucofuric acid; (4) by heating and concentrating at 60°C and using M9 medium, the lignin mother liquor was adjusted to a concentration of 500g / L, and this was used as a supplement The feed liquid is fermented to produce mucofuric acid from lignin.

[0057] 2. Using the pretreated lignin as the substrate for ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a genetically engineered bacterium for producing muconic acid by taking lignin as a raw material. The genetically engineered bacterium is a genetically engineered bacterium obtained by knocking out three genes including a muconate cycloisomerase gene, a catechol 2,3-dioxygenase gene and a protocatechuate 3,4-dioxygenase gene in rhodococcus, and inserting a protocatechuate decarboxylase gene and a protocatechuate codecarboxylase gene. According to the genetically engineered bacterium, a muconic acid degradation pathway in microorganisms is knocked out, so that the straincan utilize the lignin to produce the muconic acid; then a metabolic branch pathway of a muconic acid precursor substance-catechol is knocked out, so that more metabolic flux flows to the muconic acid, and a protocatechuate degradation pathway of the strain is knocked out so as to block the metabolic pathway of protocatechuate; and finally, an exogenous protocatechuate decarboxylase gene and an isoprene cofactor enzyme gene are introduced to connect the protocatechuate to a metabolic pathway of catechol so as to expand the substrate spectrum of the strain. The genetically engineered bacteriumdisclosed by the invention can produce the muconic acid by utilizing the lignin, so that high-valued utilization of the lignin is realized.

Description

technical field [0001] The invention belongs to the technical field of genetic engineering, and relates to a genetically engineered bacterium that uses lignin as a raw material to produce mucofuroic acid. Background technique [0002] Lignocellulosic biomass, such as agricultural straw and forestry waste, is a renewable resource and the most likely substitute for fossil resources. The main components of lignocellulose include cellulose, hemicellulose and lignin, among which cellulose and hemicellulose can be converted into ethanol, oil and other products more efficiently through pretreatment technology, enzymatic hydrolysis technology and microbial fermentation technology (Sun Mingrong, Liu Xiaoxin, Xie Wenhua, et al. Development Thoughts and Prospects of Biorefinery Economy [J]. Chemical Industry Progress, 2017,36(09):3250-3256.). However, due to the complex structure of lignin and the characteristics that it is difficult to be degraded and utilized, there is no efficient ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N1/21C12N15/60C12N15/74C12N15/66C12P7/44C12R1/01
CPCC12N9/88C12Y401/01063C12N15/74C12N15/66C12P7/44Y02A50/30
Inventor 金明杰蔡成固许召贤徐美林
Owner NANJING UNIV OF SCI & TECH
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com