RT-RPA primer, probe, kit and detection method for detecting type II grass carp reovirus (GCRV)
A reovirus and kit technology, applied in the field of RT-RPA primers for detecting type II grass carp reovirus, can solve the problems of complex operation, time-consuming and laborious, unfavorable epidemiological investigation of grass carp haemorrhagic disease, etc.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0061]Example 1 Screening and verification of primers and probes
[0062]1. Virus strain and strain genomic RNA extraction
[0063]Based on the genomic RNA extraction kit specification, a strain and strain separated by the laboratory: II GCRV, SVCV, FV-3, ISKNV, IHNV, CEV, KHV, TILV, Type I GCRV, III GCRV and Victorian Somaramidi, RNA of Weld Gas Somara Subconsigraphon, and prepares the concentration of ultra - versus spectrophotometer.
[0064]2. Conservative sequence
[0065]Download generated sequences of genetical type II straw fish in the NCBI gene bank, sequence comparison with DNAMAN software to find relative conservative sequences.
[0066]Conserved sequences is determined as follows: 5'-atgttgcgaatattgccaaaaccagtggtgaccaaagtgttgagcttatcagtccctactacaagaggtgtgatagcttgaatatctgcggcggtgatctccgcactaagtggtttagccgtctgcagcatcagcaatgcaggagtaaccttagccagcttcgccgcggtcagattggtatcgtatatgatcgggataccacgcagggagtattcaagtccgcatgctgggagtcgcttcagatcaatcatcaaatctccaccaccggagttacccatgctcaggtaatacgtcgtcttggatgttg...
Embodiment 2
[0111]Example 2 Preparation of kits for use in Type II rock causoliosis detection
[0112]A real-time fluorescent RT-RPA kit for detection of Type II ruthenium Cantormorm is: primer 3R3F, probe, detection reagent. Detection reagents include enzyme dry powder mixtures, rehydrated buffers, magnesium acetate solutions purchased from Hangzhou.
[0113]The method of use of the kit:
[0114](1) 40.9 μl of rehabilibrified buffer Abuffer was added to the enzyme dried powder mixture.
[0115](2) The upstream primer, downstream primer, and sample RNA were added to the upper and lower proda, and 2 μl of the sample RNA were added.
[0116](3) 0.6 μL of the probe of real-time fluorescent RT-RPA amplification.
[0117](4) Add 2.5 μl of magnesium acetate solution to the lid of the dry powder tube, mix well and dispel.
[0118](5) The centrifugal solution was placed in a constant temperature fluorescent detector (DHELIX-Q5), and the reaction was reacted for 30 min at 37 to 39 ° C.
[0119](6) Record fluorescence data and ...
Embodiment 3
[0123]Example 3 Sensitivity Experiment
[0124]Sensitivity detection of the kit in Example 2, including the following steps:
[0125](1) Total RNA Type II Grasspes with Virus Total RNA Extraction Kit;
[0126](2) Press the total RNA of type II strawder to press 10 times to 10 times gradient from 106COPY / μL for gradient dilution, end concentration is 106COPY / μL, 105COPY / μL, 104COPY / μL, 103COPY / μL, 102COPY / μL, 101COPY / μL;
[0127](3) Add different concentration templates in step (2), mixing centrifugation, adding the centrifugal solution system to the constant temperature fluorescent detector, and the temperature is 37 ° C, and the reaction is 30 min.
[0128]Real-time fluorescent RT-RPA method for different concentrations (101COPY / μL, 102COPY / μL, 103COPY / μL, 104COPY / μL, 105COPY / μL, 106The test results of the peak time and detection of COPY / μL, and detectionfigure 2 ,Fromfigure 2 It can be seen that the minimum detection of the real-time fluorescent RT-RPA method establishe...
PUM

Abstract
Description
Claims
Application Information

- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com