Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

RT-RPA primer, probe, kit and detection method for detecting type II grass carp reovirus (GCRV)

A reovirus and kit technology, applied in the field of RT-RPA primers for detecting type II grass carp reovirus, can solve the problems of complex operation, time-consuming and laborious, unfavorable epidemiological investigation of grass carp haemorrhagic disease, etc.

Active Publication Date: 2021-04-20
PEARL RIVER FISHERY RES INST CHINESE ACAD OF FISHERY SCI
View PDF7 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0005] There are many diagnostic methods for grass carp reovirus, each with its own advantages and disadvantages. Nucleic acid detection methods such as virus isolation, electron microscope observation, PCR, and qPCR are still commonly used methods for detecting grass carp reovirus, but these methods are time-consuming and laborious. , The operation is relatively complicated, and the virus cannot be quickly diagnosed, and because the GCRV genome is RNA, the nucleic acid detection methods for GCRV need to extract RNA and continue to reverse transcription, and the obtained cDNA is used as a template for detection, so the operation is relatively cumbersome , is not conducive to the epidemiological investigation of grass carp haemorrhagic disease
There are certain requirements for equipment and operators, and the detection takes about 2 to 5 hours. It is difficult to achieve rapid, batch and simple detection requirements on site.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • RT-RPA primer, probe, kit and detection method for detecting type II grass carp reovirus (GCRV)
  • RT-RPA primer, probe, kit and detection method for detecting type II grass carp reovirus (GCRV)
  • RT-RPA primer, probe, kit and detection method for detecting type II grass carp reovirus (GCRV)

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0061]Example 1 Screening and verification of primers and probes

[0062]1. Virus strain and strain genomic RNA extraction

[0063]Based on the genomic RNA extraction kit specification, a strain and strain separated by the laboratory: II GCRV, SVCV, FV-3, ISKNV, IHNV, CEV, KHV, TILV, Type I GCRV, III GCRV and Victorian Somaramidi, RNA of Weld Gas Somara Subconsigraphon, and prepares the concentration of ultra - versus spectrophotometer.

[0064]2. Conservative sequence

[0065]Download generated sequences of genetical type II straw fish in the NCBI gene bank, sequence comparison with DNAMAN software to find relative conservative sequences.

[0066]Conserved sequences is determined as follows: 5'-atgttgcgaatattgccaaaaccagtggtgaccaaagtgttgagcttatcagtccctactacaagaggtgtgatagcttgaatatctgcggcggtgatctccgcactaagtggtttagccgtctgcagcatcagcaatgcaggagtaaccttagccagcttcgccgcggtcagattggtatcgtatatgatcgggataccacgcagggagtattcaagtccgcatgctgggagtcgcttcagatcaatcatcaaatctccaccaccggagttacccatgctcaggtaatacgtcgtcttggatgttg...

Embodiment 2

[0111]Example 2 Preparation of kits for use in Type II rock causoliosis detection

[0112]A real-time fluorescent RT-RPA kit for detection of Type II ruthenium Cantormorm is: primer 3R3F, probe, detection reagent. Detection reagents include enzyme dry powder mixtures, rehydrated buffers, magnesium acetate solutions purchased from Hangzhou.

[0113]The method of use of the kit:

[0114](1) 40.9 μl of rehabilibrified buffer Abuffer was added to the enzyme dried powder mixture.

[0115](2) The upstream primer, downstream primer, and sample RNA were added to the upper and lower proda, and 2 μl of the sample RNA were added.

[0116](3) 0.6 μL of the probe of real-time fluorescent RT-RPA amplification.

[0117](4) Add 2.5 μl of magnesium acetate solution to the lid of the dry powder tube, mix well and dispel.

[0118](5) The centrifugal solution was placed in a constant temperature fluorescent detector (DHELIX-Q5), and the reaction was reacted for 30 min at 37 to 39 ° C.

[0119](6) Record fluorescence data and ...

Embodiment 3

[0123]Example 3 Sensitivity Experiment

[0124]Sensitivity detection of the kit in Example 2, including the following steps:

[0125](1) Total RNA Type II Grasspes with Virus Total RNA Extraction Kit;

[0126](2) Press the total RNA of type II strawder to press 10 times to 10 times gradient from 106COPY / μL for gradient dilution, end concentration is 106COPY / μL, 105COPY / μL, 104COPY / μL, 103COPY / μL, 102COPY / μL, 101COPY / μL;

[0127](3) Add different concentration templates in step (2), mixing centrifugation, adding the centrifugal solution system to the constant temperature fluorescent detector, and the temperature is 37 ° C, and the reaction is 30 min.

[0128]Real-time fluorescent RT-RPA method for different concentrations (101COPY / μL, 102COPY / μL, 103COPY / μL, 104COPY / μL, 105COPY / μL, 106The test results of the peak time and detection of COPY / μL, and detectionfigure 2 ,Fromfigure 2 It can be seen that the minimum detection of the real-time fluorescent RT-RPA method establishe...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a real-time fluorescence RT-RPA primer, probe and kit for detecting type II grass carp reovirus (GCRV) and application of the real-time fluorescence RT-RPA primer, probe and kit. The optimal combination of the primer and the probe is obtained by designing and screening a specific conserved region of the gene type II (GCRV), and the primer and the probe are high in detection sensitivity, good in specificity and stable in detection effect; and moreover, the kit and the probe have no cross reaction with 9 fish common viruses including type I GCRV and type III GCRV and bacteria, namely aeromonas veronii and aeromonas hydrophila, which are easily infected by grass carp, and show good specificity. Based on the real-time fluorescence RT-RPA primer, probe and detection kit established by the invention, the detection sensitivity of the gene type II GCRV is 10<1> copy / [mu]l and is 10 times higher than that of a nested PCR method, large-scale instruments and equipment are not needed, the detection only lasts for 4.5-30 min, the detection time is greatly shortened, and the real-time fluorescence RT-RPA primer, probe and detection kit can be used for on-site rapid detection.

Description

Technical field[0001]The present invention belongs to the field of gene detection, and more particularly to RT-RPA primers, probes, kits, and detection methods for detecting II strawder.Background technique[0002]Grass Carp Reovirus (GCRV) is affiliated with aquacine. It is a new member of the Cantorma Virus (REOVIRIDAE), aquareovirus, is the disease One of the strongest strains of power is the first fish virus isolated from mainland China. The virus mainly causes the main varieties of freshwater breeding in Asian countries such as China, North Korea, and Vietnam, and the death rates in the fish species. The mortality is generally 30% ~ 50%, up to 60% ~ 80%, can also infect green fish, wheat Spike and rare 鮈 鮈. The virus is wide, the harm is large, high mortality, and long in the episode, and seriously threatening the production of fisheries. According to incomplete statistics, the economic losses caused by the blood-proof blood of the grassfish at least 1.0 billion yuan per year, se...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12Q1/70C12Q1/6844C12N15/11C12R1/93
Inventor 李莹莹王庆曾伟伟王英英尹纪元吴斯宇石存斌
Owner PEARL RIVER FISHERY RES INST CHINESE ACAD OF FISHERY SCI
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products