Genetically engineered bacterium for exocytosis of tocotrienols and application of genetically engineered bacterium

A technology of tocotrienol and genetically engineered bacteria, which is applied in the fields of genetic engineering and metabolic engineering, can solve the problems of no reports of tocotrienol transporters, achieve good application prospects, and promote the effect of extracellular secretion

Pending Publication Date: 2021-12-07
ZHEJIANG UNIV
View PDF1 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0004] But so far, no tocotrienol transporters have been reported, either in photosynthetic organisms that naturally produce tocotrienols or in engineered microorganisms such as yeast

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Genetically engineered bacterium for exocytosis of tocotrienols and application of genetically engineered bacterium
  • Genetically engineered bacterium for exocytosis of tocotrienols and application of genetically engineered bacterium
  • Genetically engineered bacterium for exocytosis of tocotrienols and application of genetically engineered bacterium

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0034] Extraction and detection of tocotrienols in fermentation broth and organic phase.

[0035] 1. The specific method for extracting tocotrienols in Saccharomyces cerevisiae is as follows:

[0036] (1) Take 1 mL of yeast fermentation broth, centrifuge at 12000 rpm for 2 min, discard the supernatant, then wash twice with 2 mL of distilled water, discard the supernatant by centrifugation, add 200 μL of distilled water, and resuspend the bacteria;

[0037] (2) Add 500mL of grinding beads (0.1mm and 0.5mm zirconia beads in half) into a 2mL centrifuge tube, and then transfer all the resuspended bacterial solution to a 2mL centrifuge tube;

[0038] (3) Place the centrifuge tube containing the beads and bacteria in a fully automatic sample rapid grinder at 65HZ for 5 min;

[0039] (4) After grinding, place the centrifuge tube in a centrifuge at 4°C at 12000rpm, centrifuge for 10min, and discard the supernatant;

[0040] (5) Add 1 mL of acetone to the centrifuge tube for extraction...

Embodiment 2

[0049] Construction of a high-producing tocotrienol strain.

[0050] The phylloylgeranyl pyrophosphate synthase gene mutant (CrtE03M, GeneBank No. DQ016502.1) and the mitochondrial NADH kinase gene (POS5, GeneBank No. NM_001184002.1) derived from Phaffia rhodozyma were cloned into the yeast integrative type On the plasmid PUMRI-21-DPP1, the integrated plasmid PUMRI-21-DPP1 is to clone the coding gene of DPP1 into the SfiI site of the plasmid PUMRI-21. For details, please refer to the patent, the application number is CN201510001391.3. Use the following primers:

[0051] CrtE03M-F-BamHI: CGGGATCCATGGATTACGCGAACATCCTC,

[0052] CrtE03M-R-SalI: ACGCGTCGACTCACAGAGGGATATCGGCTAG,

[0053] POS5-R-SpeI: CTAGACTAGTTTAATCATTATCAGTCTGTCTCTTG,

[0054] POS5-F-NotI: ATAAGAATGCGGCCGCATGTTTGTCAGGGTTAAATTG.

[0055] Using genomic DNA as a template, high-fidelity enzyme (Prime START HS DNA polymerase) was used for PCR amplification. The reaction system (50μL) is as follows:

[0056]

...

Embodiment 3

[0063] Optimization of in situ extraction conditions of tocotrienols.

[0064] Add 5% (v / v) dodecane or sunflower oil or olive oil to the medium, and analyze the tocotrienol production and secretion ratio of the engineering strain ( figure 2 ), confirming that olive oil is an ideal extractant of tocotrienols. In order to further promote the secretion of tocotrienols, the amount and time of adding olive oil were optimized, adding 5%, 10%, 20%, 30%, 40% (v / v) olive oil or A two-phase fermentation system of strain YVT17 was established by adding 5% (v / v) olive oil as in-situ extractant at different time periods. After culturing for 96 hours, the fermentation broth was collected by centrifugation, and the organic phase was directly diluted 10-30 times with acetone for HPLC detection. The results showed that the extracellular secretion ratio of tocotrienols reached 56.12%, and compared with single-phase culture, the total tocotrienol production increased by 5.51% ( image 3 ). ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a genetically engineered bacterium for exocytosis of tocotrienols and application of the genetically engineered bacterium. A genetically engineered bacterium for exocytosis of tocotrienol comprises a chassis strain and an import gene transferred into the chassis strain, the chassis strain is an engineered strain for producing tocotrienol, and the import gene comprises a geranyl geranyl pyrophosphate synthase gene mutant CrtE03M from phaffia rhodozyma and a mitochondrial NADH kinase encoding gene POS5. The yield of tocotrienol is increased by increasing the content of a precursor GGPP of tocotrienol and the supply of a cofactor NADPH (Nicotinamide Adenine Dinucleotide Phosphate).

Description

technical field [0001] The invention relates to the fields of genetic engineering and metabolic engineering, in particular to a genetically engineered bacterium for extracellular secretion of tocotrienol and its application. Background technique [0002] Tocotrienols (Tocotrienols) is an important component of vitamin E, is an excellent antioxidant, has a variety of functions such as lowering cholesterol, neuroprotection and radiation protection, anti-cancer, etc. great application potential. Due to the lack of chemical synthesis pathways, the current supply of tocotrienols relies on plant extraction, but there are problems such as occupying farmland, long growth cycle, and vulnerability to climate change. In recent years, the biosynthesis of tocotrienols using engineered microbial cell factories has received extensive attention. In 2008, delta-tocotrienol was first synthesized in Escherichia coli with a yield of 15 μg / g dry cell mass (DCW). In 2020, delta-tocotrienol bio...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N1/19C12N15/81C12N15/54C12N15/31C12P17/06C12R1/865
CPCC12N9/1205C12N9/1085C07K14/395C12N15/81C12P17/06C12Y207/01086C12Y205/01001
Inventor于洪巍叶丽丹焦学
OwnerZHEJIANG UNIV