Oxidase whole-cell catalyst and method for preparing high-optical-purity R-type 1, 3-butanediol by using oxidase whole-cell catalyst

A whole-cell catalyst and oxidase technology, which is applied in the field of biocatalytic preparation of R-type 1,3-butanediol, can solve the problems of toxic excipients polluting the environment, high price of threonine, and difficult control, etc., to reduce reaction impurities, The effect of high reaction efficiency and simple process

Pending Publication Date: 2022-05-13
INST OF MICROBIOLOGY - CHINESE ACAD OF SCI
View PDF0 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Also need to use inorganic lithium as catalyst in the reaction simultaneously, and the raw material threonine price in this method is higher, and each step control difficulty is bigger, and yield is low, and toxic auxiliary material pollutes the environment

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Oxidase whole-cell catalyst and method for preparing high-optical-purity R-type 1, 3-butanediol by using oxidase whole-cell catalyst
  • Oxidase whole-cell catalyst and method for preparing high-optical-purity R-type 1, 3-butanediol by using oxidase whole-cell catalyst
  • Oxidase whole-cell catalyst and method for preparing high-optical-purity R-type 1, 3-butanediol by using oxidase whole-cell catalyst

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0033] Preparation of genetically engineered bacteria with high production of oxidase or reductase:

[0034] Primers were designed according to the sequences of the Ad5SSDH and LnSSFabG genes of Saccharolobus solfataricus:

[0035] Ad5SSDH, its sequence is shown in the sequence table SEQ NO.1, its amplification primer:

[0036] Forward primer: CGC CATATG agagcagttagattggtagaaataggaa, the underlined sequence is the enzyme cutting site NdeI.

[0037] Reverse primer: CC GGATCC tggtattaatacttgccttcc, the underlined sequence is the HindIII restriction site. The sequence of the gene product is shown in SEQ NO.2 of the sequence table.

[0038] The two ends of the gene sequence obtained after PCR amplification have NdeI and HindIII sites, and the gene sequence obtained after PCR amplification is inserted into the pET30a vector, and the high-expression genetic engineering vector plasmid obtained is named pET30Ad5SSDH, and then The plasmid pET30Ad5SSDH was transformed into the re...

Embodiment 2

[0058] Expression and purification of oxidase Ad5SSDH or reductase LnSSFabG

[0059] (1) Activation in the seed culture medium The colonies of the high-yield oxidase genetically engineered bacteria and the high-yield reductase genetically engineered bacteria on the petri dish were respectively placed in 5mL LB (Kan100μg / mL) medium, and the seeds activated overnight at 37°C and 200rpm liquid.

[0060] (2) Fermentation culture Inoculate 10% of overnight activated seed solution into 800 mL LB fermentation medium (kan 100 g / mL) and culture at 37° C. and 200 rpm until OD600=0.6 in the mid-logarithmic phase.

[0061] (3) Induction culture Lactose was added for induction at the mid-log phase, so that the final concentration was 1 mM, and the induction culture was carried out at 25-30° C. and 180 rpm for 4-6 hours.

[0062] (4) SDS-PAGE Take 4 mL of the fermented broth that has been induced, centrifuge at 12,000 rpm for 90 sec, add 800 μL of deionized water, and sonicate for 5 min. ...

Embodiment 3

[0069] The method for preparing Ad5SSDH oxidase whole-cell catalyst and the experiment of converting racemate 1,3-BDO into R-1,3-BDO by using the whole-cell catalyst:

[0070] (1) Activation of seed medium Pick a single colony on a petri dish and place it in 5 mL of LB (Kan 100 μg / mL) medium, and activate overnight at 37° C. and 200 rpm.

[0071] The seed medium is LB medium, and the formula is as follows: peptone 10g / L, yeast extract 5g / L, NaCl 10g / L; NH3·H2O adjusted to pH 7.0, the plate medium is LB medium and 15g / L agar powder is added, Sterilize at 121°C for 20 minutes.

[0072] (2) Fermentation culture Inoculate 10% of the overnight activated seed solution into 1L TB fermentation medium (Kan 100 μg / mL) and culture at 37°C and 200 rpm until mid-log phase OD600=0.6-1.

[0073] The fermentation medium is TB medium, and the formula is as follows: peptone 12g / L, yeast extract 24g / L, glycerin 4ml / L, set the volume to 900mL, and prepare 100ml 0.17M potassium dihydrogen phospha...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

PropertyMeasurementUnit
boiling pointaaaaaaaaaa
flash pointaaaaaaaaaa
Login to view more

Abstract

The invention relates to an oxidase whole-cell catalyst and a method for preparing high-optical-purity R-type 1, 3-butanediol by using the oxidase whole-cell catalyst. The invention relates to the technical field of preparation of R-type 1, 3-butanediol through biological catalysis. The invention provides an oxidase whole-cell catalyst. A preparation method of the oxidase whole-cell catalyst comprises the following steps: after an Ad5SSDH gene is subjected to PCR (Polymerase Chain Reaction) amplification, inserting the Ad5SSDH gene into a pET30a carrier to obtain a plasmid pET30Ad5SSDH; the method comprises the following steps: transforming a plasmid pET30Ad5SSDH into recipient bacteria escherichia coli BL21 (DE3), so as to obtain a genetically engineered bacterium with high oxidase yield; and purifying the high-yield oxidase gene engineering bacteria to obtain the oxidase whole-cell catalyst. According to the method disclosed by the invention, the enzymatic production of R-1, 3-BDO is completely carried out by adopting a biological enzyme technology, and compared with a chemical method, the pollution to the environment in the production process is reduced. The feeding concentration reaches 6%, the conversion time is 36 hours, the conversion rate is 80%, and the chiral purity is 99.2%.

Description

technical field [0001] The invention relates to the technical field of biocatalytic preparation of R-type 1,3-butanediol. Background technique [0002] R-type 1,3-butanediol (abbreviated as R-1,3-BDO), is a colorless, odorless, low toxicity, slightly bitter-sweet viscous liquid with a boiling point of 207.5°C, a relative density of 1.01, and a flash point 121°C, ignition temperature 393.9°C, slightly soluble in ether, easily soluble in water, ethanol, acetone, etc., insoluble in aliphatic hydrocarbons, toluene, mineral oil, etc. [0003] R-1,3-BDO is an important chiral compound, which can be used in the synthesis of pheromones, spices, carbapenem core-azetidinone and insecticides. [0004] R-1,3-BDO can be synthesized by organic chemistry, but the steps in the synthesis process are cumbersome. For example, Larchevsque used threonine as a substrate to obtain R-1,3-BDO with a yield of 64% through four steps of nitrosation deamination, esterification, hydrogenolysis debromin...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
Patent Type & Authority Applications(China)
IPC IPC(8): C12N15/70C12N15/53C12N1/21C12P7/18C12P7/26C12R1/19
CPCC12N15/70C12N9/0006C12N9/0008C12P7/18C12P7/26C12Y102/01016C12Y101/011
Inventor 王建军吴胜
Owner INST OF MICROBIOLOGY - CHINESE ACAD OF SCI
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap