Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Method for producing hyaluronic acid and its special strain

A technology of bacillus and streptococcus, applied in the field of hyaluronic acid production, can solve the problems of limiting hyaluronic acid production, cell toxicity, low dissolved oxygen, etc., to increase hyaluronic acid production, reduce lactic acid production, and promote synthesis Effect

Inactive Publication Date: 2008-02-06
TSINGHUA UNIV
View PDF1 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, due to the very high viscosity of the fermentation broth, the dissolved oxygen is very low, and the O 2 And some intermediate peroxides are toxic to cells, which limits the improvement of hyaluronic acid production

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method for producing hyaluronic acid and its special strain
  • Method for producing hyaluronic acid and its special strain

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0018] Embodiment 1, the construction of the vector pEUHB containing phbCAB gene

[0019] Strains: Escherichia coli E.coli JM109

[0020] The medium used for constructing the plasmid was (g / l): peptone 10, yeast extract 5, NaCl 10, spectinomycin 100 μg / l.

[0021] The process of constructing pEUHB is shown in Figure 3, including the following steps: 1) Under standard polymerase chain reaction conditions, use the pBHR68 plasmid (supplied by Steinbüchel of Münster University in Germany) as a template and P phbCAB -up: ATA AAGCTT (HindIII)AAGGAGGATGGCGACCGGCAAAGGC and P phbCAB -do:GTT ATCGAT (Cla I) CGGCAGGTCAGCCCATAT is a primer to obtain a 3884bp DNA amplification fragment, and its gene sequence is SEQ ID NO: 1 in the gene sequence list.

[0022]PCR reaction conditions: 96°C for 45 seconds, 66°C for 1 minute, 72°C for 4 minutes and 30 seconds, a total of 30 cycles.

[0023] 2) The amplified DNA fragment containing the phbCAB gene was digested with restriction endonuclease...

Embodiment 2

[0024] Embodiment 2, the preparation of Streptococcus zooepidemicus competent cell and electrotransformation method

[0025] Strains: Streptococcus zooepidemicus ATCC 39920

[0026] The medium used in the transformation was THYB (g / l): todd-hewitt broth 36.4, yeast extract 0.5% (w / v), spectinomycin 100 mg / l.

[0027] 1) Preparation of Competent Cells

[0028] 1) Cultivate Streptococcus zooepidemicus ATCC 39920 overnight in THYB medium;

[0029] II) it is inoculated into the fresh THYB substratum of 50ml, after inoculation D 530 No more than 0.05, cultivated to OD 530 About 0.25 or so;

[0030] III) Add hyaluronidase 0.4 mg / ml half an hour before the end of the culture;

[0031] IV) 4°C, 8000g, centrifuge for 10 minutes, discard the supernatant, and resuspend the cells with 20mL 0.5M sucrose solution;

[0032] V) Centrifuge at 8000g for 10 minutes at 4°C, discard the supernatant, resuspend the cells with 1mL of 0.5M sucrose solution, centrifuge again, and discard the supe...

Embodiment 3

[0041] Embodiment 3, the detection of PhbB (acetoacetyl-CoA reductase) enzymatic activity in recombinant bacteria

[0042] Strains: Recombinant Streptococcus zooepidemicus

[0043] Foreign gene: phbCAB

[0044] The medium used was THYB (g / l): todd-hewitt broth 36.4, yeast extract 0.5% (w / v), spectinomycin 100 mg / l, IPTG 20 mM.

[0045] 1) Enzyme activity assay method

[0046] The total reaction volume is 500ul, including 12.5ul 10mmol / l NADPH, 12.5ul7mmol / l acetyl-CoA and 425ul buffer (120mmol / l potassium phosphate, 24mmol / l magnesium chloride, 1mmol / l dithiothreitol), first at 30°C Preheat for 1 minute, then add 50ul enzyme crude extract, and immediately detect the change of absorbance at 340nm. One PhbB enzyme activity unit (U) is defined as the degradation of 1umol NADPH in 1 minute. The preparation of the enzyme crude extract is as follows: the cells were cultured at 37°C for 14 hours under the condition of adding IPTG, the supernatant was discarded by centrifugation, ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The production process of hyaluronic acid includes constructing a plasmid expressing vector containing phbCAB gene sequence, and introducing into streptococcus for expression. The constructed plasmid expressing vector pEUHB is obtained through inserting the gene sequence phbCAB into the polyclonal site of plasmid vector pEU308. The streptococcus is preferably epizootic streptococcus. The present invention is used in the industrial fermentation of producing hyaluronic acid, and can promote strain growth and promote the synthesis of hyaluronic acid to raise the yield of hyaluronic acid.

Description

technical field [0001] The invention relates to a method for producing hyaluronic acid and a special bacterial strain thereof. Background technique [0002] Hyaluronic acid (HA), also known as hyaluronic acid, is a highly viscous substance that Meyer and Palmer first isolated from the vitreous humor of bovine eyes in 1934 (Meyer K., Palmer J.W. The polysaccharide of the vitreous humor.J .biol.chem, 1934, 107:629-634). Since then, people have done a lot of research on the distribution, chemical structure, physiological function and clinical application of HA, especially after Balazs used HA for the first time in 1960 for complex retinal detachment surgery and achieved ideal curative effect. A series of significant progress has been made in the field of medical application research. As a biochemical drug, HA is not only widely used in medicine, but also has broad application prospects in the daily chemical industry, especially the cosmetics industry (Chen Tonglai. 41 kinds o...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N1/21C12N15/74C12N15/87C12R1/46
Inventor 陈国强张晋宇
Owner TSINGHUA UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com