Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Process for preparing human leucocyte interleukin 24 by genetic engineering and it expressing carrier and engineering bacterium

A technology of interleukin and genetically engineered bacteria, which is applied in the field of genetic engineering preparation of human interleukin 24 and its expression vector and engineered bacteria, can solve the problems of no experimental research on biological activity verification, short-term effects, and application limitations. To achieve the effect of improving the refolding effect and yield

Inactive Publication Date: 2008-08-06
ARMY MEDICAL UNIV
View PDF4 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, the transient expression of IL-24 in tumor cells is mediated by adenovirus, and the effect of inducing apoptosis is very significant. There are problems.
There are two literatures in China, one is transiently expressed in COS cells, and its effect of inducing apoptosis is remarkable, but there is also the problem of short-term effect, which is limited in clinical application; the other is expressed in Escherichia coli IL-24 protein, but there is a big obstacle - the dissolution and refolding of its inclusion body protein is very difficult, and there is no follow-up experimental research and verification of its biological activity

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Process for preparing human leucocyte interleukin 24 by genetic engineering and it expressing carrier and engineering bacterium
  • Process for preparing human leucocyte interleukin 24 by genetic engineering and it expressing carrier and engineering bacterium
  • Process for preparing human leucocyte interleukin 24 by genetic engineering and it expressing carrier and engineering bacterium

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0039] Cloning of the coding gene of embodiment 1 human IL-24:

[0040] 1. Extraction of total RNA: Take 5 mL each of anticoagulated blood from healthy people, and collect the buffy coat with lymphocyte separation medium. Add RPMI1640 complete medium and ConA with a total concentration of 25mg / L, 37°C, 50mL / L CO 2 After incubation for 48 h, the cells were collected by centrifugation. RNA extraction kit was used to extract total RNA.

[0041] 2. RT-PCR: using total mRNA as a template, reverse transcription to obtain IL-24cDNA, the conditions are 30°C for 10s, 50°C for 30s, 99°C for 5s, 5°C for 5s, 1 cycle.

[0042] 3. PCR amplification of the target gene: Design a pair of primers according to the IL-24 sequence published by GenBank. The primers are:

[0043] P1 5'- GGTACC GACGACGACGACAAGGCCCAGGGCCAAGAATT(Kpn1)

[0044] P2 5'- GGATCC TTACAGAGCTTGTAGAATTTCTG (BamHl)

[0045] In order to avoid the introduction of two redundant amino acids Ala and Met at the N-terminal, th...

Embodiment 2

[0065] Example 2 Construction of recombinant expression plasmid pET32a(+)-IL-24 or pET32a(+)-hsIL-24 and construction and screening of high-efficiency expression engineering bacteria

[0066] 1. Construction of recombinant plasmids

[0067] The IL-24 or hsIL-24 gene amplification (PCR) product was subjected to 1.0% agarose electrophoresis, gel recovery and purification, and then ligated with the vector pMD-18T, transformed into Escherichia coli DH5α, extracted the plasmid, digested with Kpn1 and BamH1, 1.0% Identification by agarose gel electrophoresis.

[0068] Digest the pMD-18T vector and pET-32a(+) containing the IL-24 or hsIL-24 target gene with Kpn1 and BamH1, and the digested products are subjected to 1.0% agarose electrophoresis, and the target fragment gel is recovered and purified. Ligation, transformation of Escherichia coli DH5α, extraction of plasmids, digestion of Kpn1 and BamH1, and identification by 1.0% agarose gel electrophoresis. Enzyme digestion results a...

Embodiment 3

[0130] Fermentation of embodiment 3 gene recombinant bacteria

[0131] The fermentation process is as follows:

[0132] German B.Bron 10L fermenter was used. During the fermentation process, 10% of the seed bacteria were inoculated, 70% dissolved oxygen was maintained, the temperature was 37°C, and the pH was 7.0. When the A600 did not reach 2, no feed was added, and then every 0.5h. Feed once so that the final concentrations of glucose, tryptone and 8% yeast extract are 0.5%, 0.2%, and 0.2%, respectively. After the 4th feed, when the glucose concentration dropped to 0.1%, IPTG 500 μmol / L was added to induce the harvest for 4 hours.

[0133] The fermentation process is based on the batch culture controlled by cascading dissolved oxygen, and feeding is added.

[0134] The medium used in the fermentation process is the improved M9CAA medium, on the basis of M9-CAA, 0.6% yeast extract and 2mg / L ZnCl are added 2 4H 2 O, 2mg / LCoCl 2 4H 2 O, 4mg / L FeSO 4 ·16H 2 O, 5mg / L H 3...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a method used to effectively manufacture genetic engineering human interleukin with certain bioactivity and its expression vector and engineering bacterial. It adopts fusion expression vector to express hIL-24 or hsIL-24 protein. The expression vector is plasmid vector pET32a(+) with hIL-24 or hsIL-24 and their coded sequence is between Kpn1 and BamH1 enzyme cutting sites. The gene enfineering is escherichia coli and transformed to pET32a(+)-hIL-24 / BL21 or pET32a(+)-hsIL-24 / BL21 by the expression vector. The invention offers complete set technologies of dissolving, renaturation, digestion, and purification. This can make protein expression quantity reach 30%; renaturation rate be over 50%; IL-24 purity be over 95%. And it can be applied to industry large-scale production.

Description

technical field [0001] The present invention relates to the field of producing protein or polypeptide medicine by DNA recombination technology, more specifically, the present invention relates to the method for genetic engineering preparation of human interleukin-24 (human interleukin-24, hIL-24) and its mutant hsIL-24, It also relates to related expression vectors and engineering bacteria. Background technique [0002] IL-24 has a significant tumor inhibitory effect, can selectively inhibit the growth of a variety of tumors, induce tumor cell apoptosis, including human melanoma, glioblastoma, osteosarcoma, breast cancer, cervical cancer, colon cancer , lung cancer, gastric cancer, nasopharyngeal cancer, prostate cancer, etc. This inhibitory effect is independent of tumor suppressor genes such as p53, Rb and p16, and has no effect on normal cells. The mechanism of IL-24 inhibiting tumor is not yet clear, currently it is considered to play a role in inhibiting tumor through...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/63C12N15/24C12N1/21C12R1/19
Inventor 邹全明杨珺张卫军
Owner ARMY MEDICAL UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com