Unlock instant, AI-driven research and patent intelligence for your innovation.

Recombinant protein used as NT-proBNP immunodiagnosis reagent standard as well as preparation method and use thereof

A recombinant protein and immunodiagnosis technology, applied in the field of genetic engineering, can solve the problems of inability to purify, expensive protease, troublesome operation, etc., and achieve the effects of high-efficiency soluble expression, simple preparation process, and simple method.

Inactive Publication Date: 2008-07-30
ARMY MEDICAL UNIV
View PDF0 Cites 7 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

NT-proBNP in the human body is extremely low, and the normal peripheral blood concentration is about 100pg / ml; therefore, it cannot be purified from plasma (serum), and NT-proBNP is mainly produced by myocardial tissue, which makes the preparation of natural NT-ProBNP peptides very difficult
The cost of direct peptide synthesis is too high
Genetic engineering is used to prepare low-molecular-weight polypeptides, which are generally expressed by fusion proteins, which can overcome the defect of low translation efficiency when expressing low-molecular-weight polypeptides alone, and the expression products are easily degraded by proteolytic enzymes. Originality has a certain influence
Therefore, some proteases are usually used to remove the tagged protein. The tagged protein needs to be further purified and the added protease removed. The operation is cumbersome and the protease is very expensive.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Recombinant protein used as NT-proBNP immunodiagnosis reagent standard as well as preparation method and use thereof
  • Recombinant protein used as NT-proBNP immunodiagnosis reagent standard as well as preparation method and use thereof
  • Recombinant protein used as NT-proBNP immunodiagnosis reagent standard as well as preparation method and use thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0061] Embodiment one Cloning of NT-proBNP gene

[0062] 1 Primer design and synthesis

[0063]According to the BNP gene sequence (CR54976) provided by GENEBANK, the NT-proBNP coding sequence is a total of 228 bases (SEQ ID NO: 3) encoding amino acids 27-103 in the pro-BNP gene. Submit this sequence to the Graphical codon usage analyzer (http: / / guca.schoedl.del) to analyze the frequency of codons encoded by amino acids 41, 54, 69, 73, and 76 in the gene used in E.coli BL21 Lower (refer to the NT-proBNP gene codon bias analysis diagram in Figure 2, wherein the part with a column height value below 10 is a codon with a lower frequency of use in Escherichia coli), and the coding sequence was obtained after synonymous transformation SEQ ID NO: 4, the coding sequence was synthesized in ten segments and a pair of specific primers - upstream primer S1 (SEQ ID NO: 5) and downstream primer A1 (SEQ ID NO: 7) were designed. Upstream primer S1 (SEQ ID NO: 5) is 5'CGCGGATCCCACCCGCTGGG 3...

Embodiment 2

[0070] Embodiment two Construction of recombinant plasmid pET32a-NT-proBNP

[0071] Digest the pET32a vector and the recovered PCR products BamH I and Sal I for 4 hours and then use T 4 DNA ligase was ligated overnight at 4°C, took a sterile centrifuge tube, added 200 μl of competent DH5α bacteria that had been prepared, put it in ice bath, pipetted 1 μl of the ligation product into the tube, transformed the DH5α bacteria, patted the tube wall to mix, and put it in an ice bath 30 minutes, 42°C water bath for 90 seconds, take out the centrifuge tube and ice-bath for 2 minutes, add 800μl room temperature 2×YT culture medium and mix well, 37°C shaker 220rpm shaking culture for 1 hour, respectively mix 50μl, 200μl and the rest The transformed bacteria solution was spread on three ampicillin-resistant 2×YT culture plates, cultured overnight in a constant temperature incubator at 37°C, and the white colonies were picked and inoculated on 2×YT medium for expansion on the next day...

Embodiment 3

[0072] Embodiment three Enzyme digestion identification of pET32a-NT-proBNP recombinant plasmid

[0073] Precipitate bacteria, centrifuge at 12000rpm for 1 minute, discard the supernatant, blot dry as much as possible, resuspend the above bacterial pellet with 150μl pre-cooled solution I, shake vigorously, and mix 300μl freshly prepared solution II by inverting gently for 5 times, and place in an ice bath 3-5 minutes, make it clear, add 150 μl of pre-cooled solution III, mix gently, and then ice-bath for 10 minutes, so that the protein is evenly distributed in the water phase, add 150 μl of pre-cooled solution IV, mix gently, and centrifuge at 12000 rpm 10 minutes. Carefully draw the aqueous phase (about 400 μl) and transfer to another 1.5ml centrifuge tube, add 2 μl RNaseA (10 μg / ml), and bathe in water at 55°C for 10 minutes. Add 400 μl Tris-phenol and 400 μl chloroform, vortex and mix well, and centrifuge at 12000 rpm for 10 minutes. Take the supernatant to another 1....

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
Molecular weightaaaaaaaaaa
Login to View More

Abstract

The invention relates to NT-proBNP recombinant albumin. The NT-proBNP recombinant albumin is provided with the amino acid sequence chosen from a) or b): a). the amino acid sequence showed in SEQ ID NO: 1; b). the amino acid sequence with NT-proBNP recombinant albumin reactivity after one or more amino acids are deleted, replaced or inserted. The invention also relates to a nucleotide sequence for coding the NT-proBNP recombinant albumin and a preparation method of the NT-proBNP recombinant albumin. The NT-proBNP recombinant albumin is provided with the immunogenicity the same as the NT-proBNP albumin, and high purity and better stability, which can replace the e natural NT-proBNP polypeptide, is used as a NT-proBNP immunologic diagnosis reagent standard, and establishes basis for further researching and developing the NT-proBNP detection kit.

Description

technical field [0001] The invention relates to the field of genetic engineering, in particular to a recombinant protein used as a standard NT-proBNP immunodiagnostic reagent, a preparation method and application thereof. Background technique [0002] Cardiovascular disease is an important disease that seriously threatens human life and health in China and even in the world. The World Health Organization pointed out in a communiqué issued in Geneva on the 5th "World Heart Day" on September 26, 2004 that 17 million people die from heart disease and other cardiovascular diseases every year, accounting for about It is estimated that by 2020, this number will exceed 20 million, and cardiovascular disease and stroke will become the leading causes of human death and disability. Among them, Heart Failure (HF) is a pathological syndrome among cardiovascular diseases that seriously endanger human health. of a stage. From the initial risk factors (hypertension, hypercholesterolemia...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C07K14/575C12N15/16C12N15/70G01N33/68
Inventor 易维京胡川闽黄洪涛李淑慧李鹏
Owner ARMY MEDICAL UNIV