Recombinant protein used as NT-proBNP immunodiagnosis reagent standard as well as preparation method and use thereof
A recombinant protein and immunodiagnosis technology, applied in the field of genetic engineering, can solve the problems of inability to purify, expensive protease, troublesome operation, etc., and achieve the effects of high-efficiency soluble expression, simple preparation process, and simple method.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0061] Embodiment one Cloning of NT-proBNP gene
[0062] 1 Primer design and synthesis
[0063]According to the BNP gene sequence (CR54976) provided by GENEBANK, the NT-proBNP coding sequence is a total of 228 bases (SEQ ID NO: 3) encoding amino acids 27-103 in the pro-BNP gene. Submit this sequence to the Graphical codon usage analyzer (http: / / guca.schoedl.del) to analyze the frequency of codons encoded by amino acids 41, 54, 69, 73, and 76 in the gene used in E.coli BL21 Lower (refer to the NT-proBNP gene codon bias analysis diagram in Figure 2, wherein the part with a column height value below 10 is a codon with a lower frequency of use in Escherichia coli), and the coding sequence was obtained after synonymous transformation SEQ ID NO: 4, the coding sequence was synthesized in ten segments and a pair of specific primers - upstream primer S1 (SEQ ID NO: 5) and downstream primer A1 (SEQ ID NO: 7) were designed. Upstream primer S1 (SEQ ID NO: 5) is 5'CGCGGATCCCACCCGCTGGG 3...
Embodiment 2
[0070] Embodiment two Construction of recombinant plasmid pET32a-NT-proBNP
[0071] Digest the pET32a vector and the recovered PCR products BamH I and Sal I for 4 hours and then use T 4 DNA ligase was ligated overnight at 4°C, took a sterile centrifuge tube, added 200 μl of competent DH5α bacteria that had been prepared, put it in ice bath, pipetted 1 μl of the ligation product into the tube, transformed the DH5α bacteria, patted the tube wall to mix, and put it in an ice bath 30 minutes, 42°C water bath for 90 seconds, take out the centrifuge tube and ice-bath for 2 minutes, add 800μl room temperature 2×YT culture medium and mix well, 37°C shaker 220rpm shaking culture for 1 hour, respectively mix 50μl, 200μl and the rest The transformed bacteria solution was spread on three ampicillin-resistant 2×YT culture plates, cultured overnight in a constant temperature incubator at 37°C, and the white colonies were picked and inoculated on 2×YT medium for expansion on the next day...
Embodiment 3
[0072] Embodiment three Enzyme digestion identification of pET32a-NT-proBNP recombinant plasmid
[0073] Precipitate bacteria, centrifuge at 12000rpm for 1 minute, discard the supernatant, blot dry as much as possible, resuspend the above bacterial pellet with 150μl pre-cooled solution I, shake vigorously, and mix 300μl freshly prepared solution II by inverting gently for 5 times, and place in an ice bath 3-5 minutes, make it clear, add 150 μl of pre-cooled solution III, mix gently, and then ice-bath for 10 minutes, so that the protein is evenly distributed in the water phase, add 150 μl of pre-cooled solution IV, mix gently, and centrifuge at 12000 rpm 10 minutes. Carefully draw the aqueous phase (about 400 μl) and transfer to another 1.5ml centrifuge tube, add 2 μl RNaseA (10 μg / ml), and bathe in water at 55°C for 10 minutes. Add 400 μl Tris-phenol and 400 μl chloroform, vortex and mix well, and centrifuge at 12000 rpm for 10 minutes. Take the supernatant to another 1....
PUM
| Property | Measurement | Unit |
|---|---|---|
| Molecular weight | aaaaa | aaaaa |
Abstract
Description
Claims
Application Information
Login to View More 