Test paper strip for detecting encephalitis virus specificity IgG antibody, method for making same and applications

A Japanese encephalitis virus and antibody detection technology, applied in measuring devices, instruments, scientific instruments, etc., can solve the problems of routine use, time-consuming, complicated operation, etc. Simple to use effects

Active Publication Date: 2009-02-11
辽宁迪浩生物科技有限公司
View PDF0 Cites 4 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

The neutralization test has high specificity and sensitivity, but the operation is complicated and requires a large number of animals or tissue culture tubes, which takes a long time and is not suitable for routine use in clinical diagnosis, but is valuable in serological epidemiological investigation and virus identification

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Test paper strip for detecting encephalitis virus specificity IgG antibody, method for making same and applications
  • Test paper strip for detecting encephalitis virus specificity IgG antibody, method for making same and applications
  • Test paper strip for detecting encephalitis virus specificity IgG antibody, method for making same and applications

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0033] The preparation of embodiment 1 Japanese encephalitis virus E gene antigen domain III

[0034] (1) Obtaining the target gene

[0035] According to the sequence of the target gene fragment and the characteristics of the pGEX-4T-1 expression vector, design primers containing restriction enzymes BamH1 and HindIII restriction sites at both ends:

[0036] 5'TAAGGATCCCACCTGAAATGTAGGCTG3'

[0037] 5'CGGGAAGCTTGAAGACCCCTCCAATAGA3'

[0038] The total viral RNA was extracted by conventional methods, and then RT-PCR was performed immediately, and the reverse transcription product was identified and recovered by 1% agarose gel electrophoresis.

[0039] (2) Cloning of the target gene and screening of positive recombinants

[0040] Ligate the recovered PCR amplification product with the PMD-18T cloning carrier overnight at 16°C, transform into DH5a competent cells, pick a monoclonal strain, culture overnight at 37°C, extract the plasmid, and use the plasmid as a template to carry ...

Embodiment 2

[0049] The preparation of embodiment 2 Japanese encephalitis virus E gene antigen domain III polyclonal antibody

[0050] (1) Animal immunity:

[0051] New Zealand white rabbits of 1-2 kg were selected, and subcutaneously injected with Japanese encephalitis virus E gene antigen domain III at multiple points on the back, and the immunization dose was 0.5-1 mg / kg. A total of 3 to 5 times of immunization.

[0052] (2) Immunological titer detection:

[0053] Coat the Japanese encephalitis virus E gene antigen domain III protein microtiter plate, 4 μg per well. The titer of immune serum was detected by indirect ELISA method. When the serum titer reaches 1:20000 or more, serum can be collected.

[0054] (3) Antibody purification and verification:

[0055] Purification by conventional octanoic acid method. The purity was checked by non-denaturing PAGE electrophoresis, showing a protein band. The activity is tested by ELISA, and the titer is greater than 1:20000.

Embodiment 3

[0056] Example 3 Japanese encephalitis virus-specific IgG antibody colloidal gold rapid detection test strip (see Figure 1)

[0057] (1) Preparation of colloidal gold-antibody conjugates:

[0058] The optimum labeling pH value of JE virus E gene antigen domain III or anti-human IgG monoclonal antibody is 8.0, and the ratio of JE virus E gene antigen domain III and colloidal gold is 18 μg / ml colloidal gold; anti-human IgG monoclonal antibody The optimal ratio of antibody to colloidal gold is 20μg / ml colloidal gold. After being treated with a stabilizer (containing 0.05% BSA, pH 8.0, 0.01 MTris buffer solution), it was evenly adsorbed on a glass fiber membrane in an amount of 65 μl per square centimeter, freeze-dried, and set aside.

[0059] (2) Coating antigen on nitrocellulose membrane:

[0060] Dilute the JE virus E gene antigenic domain III to 3.5 mg / ml, dilute the anti-JE virus polyclonal antibody or anti-mouse IgG antibody to 2 mg / ml, spray on the nitrocellulose membrane...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides a colloidal gold test strip for the detection of Japanese encephalitis virus specific IgG antibody. A Japanese encephalitis virus E gene antigen domain III and an anti III polyclonal antibody are coated on a nitrate cellulose film (NC film), and a membrane chromatography double antigen sandwich method is adopted to detect the Japanese encephalitis virus specific IgG antibody in an animal or human body serum specimen in combination with a colloidal gold labeled Japanese encephalitis virus E gene antigen domain III. Or the Japanese encephalitis virus E gene antigen domain III and an anti-mouse IgG are coated on the nitrate cellulose film (NC film), and a capture method is adopted to detect the Japanese encephalitis virus specific IgG antibody in the human body serum specimen in combination with a colloidal gold labeled antihuman monoclonal antibody. The test strip is simple in operation, convenient, and fast, and has the advantages of no requirements of special instruments and special training, clear and identified result, and easy popularization. The test strip is suitable for base course, site detection and epidemiological investigation, has auxiliary effect on the diagnosis of Japanese encephalitis virus infection, and can be used for the effect observation after vaccination.

Description

technical field [0001] The invention belongs to the field of biological detection, and in particular relates to a Japanese encephalitis virus specific IgG antibody detection test strip, a preparation method and application thereof. Background technique [0002] Japanese encephalitis (JE), referred to as JE, is an infectious disease of the central nervous system caused by neurotropic JE virus (JEV) [1]. It is spherical, with a diameter of 20-30nm. The core contains single-stranded RNA, has a capsid, and has three structural proteins, namely E protein, nucleoprotein C and membrane protein M.E protein is a glycoprotein, wrapped on the surface of the virus, which determines the virus Its virulence and its host range not only play an important role in binding to host cell receptors and subsequent membrane fusion, but also stimulate the production of neutralizing antibodies and play a major role in immune protection. It is typically characterized by febrile headache followed by a...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): G01N33/577G01N33/576G01N33/558G01N33/545
Inventor刘明
Owner辽宁迪浩生物科技有限公司