Fusion gene fragment rolB-FGFs and application thereof

A technology for fusing gene fragments and genes, applied in the biological field, to achieve the effect of increasing the induction rate

Inactive Publication Date: 2010-07-07
JILIN AGRICULTURAL UNIV
View PDF0 Cites 8 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

People worry that in the process of commercial planting of genetically modified crops, herbicide genes may be naturally hybridized, and antibiotic genes may be transfected by intestinal bacteria, resulting in natural non-transgenic crops being resistant to herbicides and humans to antibiotics

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Fusion gene fragment rolB-FGFs and application thereof
  • Fusion gene fragment rolB-FGFs and application thereof
  • Fusion gene fragment rolB-FGFs and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0035] Embodiment 1: The construction of the plant secretory expression vector pCAMBIA1390-PMI-SEAP without antibiotic marker

[0036] (1) Annealing of SEAP signal peptide oligonucleotide chain

[0037] Necessary modifications were made to the artificially synthesized SEAP signal peptide gene sequence (synthesized by Beijing Sanbo Polygala Biological Co., Ltd.), that is, beneficial Kpn I, Nco I and BstB I, EcoR I enzyme cutting sites connected by subsequent sequences.

[0038] Positive chain:

[0039] 5'-CATGTTGGGACCATGCATGCTTCTTCTCTTGCTTTTGCTCGGACTCCGTCTCCAACTCTCCCTAGGATCACTGTCAGACTAGTT-3'

[0040] Negative chain:

[0041] 5'-CGAACTAGTCTGACAGTGATCCTAGGGAGAGTTGGAGACGGAGTCCGAGCAAAAGCAAGAGAAGAAGCATGCATGGTCCCAA-3'

[0042] The two synthesized oligonucleotide chains were respectively dissolved in TE so that the final concentration was 25 μmol / L.

[0043] Annealing reaction system: positive strand 2.0μl

[0044] Negative strand 2.0μl

[0045] NaCl...

Embodiment 2

[0062] Example 2: Construction of plant secreted binary expression vector pCAMBIA1390-PIM-SEAP-rolB-FGFs without antibiotic markers

[0063] The cDNA sequence of the rolB gene was found in Genebank, primers were designed using the online software Primer5.0 and DNAStar, the EcoR I restriction site was introduced into the upstream primer R1, and the downstream primer R2 contained part of the bases at the 5' end of the FGFs gene; artificially synthesized Primers (synthesized by Beijing Yuanzhi Biological Company)

[0064] R1: GAATTCTTGAAGGAAAACTTCTCCACC

[0065] R2: TTCTTGTAGTTAGCCATTTGTAGTCG

[0066] Using the Ri plasmid in Agrobacterium rhizogenes A4 (provided by Changchun Zuojia Institute of Special Products, Chinese Academy of Sciences) as a template, the full-length sequence of the rolB gene was amplified by PCR reaction. The PCR reaction conditions and system were as follows (Table 1, Table 2 ):

[0067]

[0068] The primers were designed based on the cDNA sequence of...

Embodiment 3

[0075] Example 3: Agrobacterium rhizogenes A4 mediates genetic transformation of ginseng

[0076] The pCAMBIA1390-PIM-SEAP-rolB-FGFs plasmid DNA without resistance marker was transformed into Agrobacterium rhizogenes A4:

[0077] Take 1 μl of CAMBIA1390-PIM-SEAP-rolB-FGFs plasmid DNA and add it to 100 μl Agrobacterium rhizogenes A4 competent cells, mix gently, place in ice bath for 5 minutes; freeze in liquid nitrogen for 5 minutes; quickly transfer to 37°C water bath Incubate in medium for 5 minutes; add 1ml of YEB medium, shake and culture on a shaker at 28°C at 180rpm for 4 hours; take an appropriate amount of bacterial liquid and apply it to YEB solid medium containing streptomycin 50mg / L and kanamycin 50mg / L, and place in Cultivate at 28°C for 24-48 hours, and obtain a single colony of Agrobacterium rhizogenes A4 carrying pCAMBIA1390-PIM-SEAP-rolB-FGFs plasmid DNA through resistance screening, PCR detection and enzyme digestion detection; containing pCAMBIA1390-PIM-SEAP-r...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

No PUM Login to view more

Abstract

The invention discloses a fusion gene fragment rolB-FGFs, which consists of a rolB gene and an FGFs gene that is designed according to the preference of a plant codon, wherein a PIM gene without the antibiotic marker and a human secreted alkaline phosphatase signal peptide (SEAP) gene are introduced; a plant secreted binary expression vector without the antibiotic marker is constructed; the expression vector is transformed into agrobacterium rhizogene; by taking the plant as the host and adopting a hairy root system to express the FGFs, the active FGFs can be purified from a hairy root and culture solution respectively, and the FGFs can be prepared industrially, thereby improving the inductivity, the expressed protein amount, the yield and the stability of the hairy root; and no antibiotic marker exists in the method, thereby protecting the environment. The ginseng hairy root containing the FGFs prepared by taking the ginseng as the host has the double pharmacological effects of the ginseng and the FGFs, thereby being a better health-care product or medicine; in addition, the ginseng hairy root is used for the development and the application of the functional food and medicine and has wide prospect.

Description

technical field [0001] The invention relates to the biological field, specifically a fusion gene fragment rolB-FGFs and its application. Background technique [0002] FGFs (fibroblast growth factors) are effective regulators in cell proliferation, variation and normal growth, and they are involved in pathological tumor processing and metastasis (Gaizie, et al, Biochem, Cell Biol, 1997, 75:669 ). FGFs have a wide range of biological activities, which are derived from nerve tissue, pituitary, adrenal cortex, retina, corpus luteum and placenta, etc., and can stimulate the proliferation of all cells derived from mesoderm and many cells derived from neuroectoderm and endoderm. In vivo, FGFs have chemotactic and mitogenic effects on endothelial cells, and promote angiogenesis; participate in various pathological damages caused by excessive cell proliferation and excessive angiogenesis. FGFs are considered to be the first molecules to stimulate vascular cell proliferation, migrat...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
Patent Type & Authority Applications(China)
IPC IPC(8): C12N15/62C12N15/82C12N1/21A01H5/06C07K14/50A23L1/29C12R1/01A23L33/00
Inventor 李校堃李海燕杨晶刘秀明王艳芳李天航熊丽东
Owner JILIN AGRICULTURAL UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap