Human apolipoprotein AI genetic engineering preparation method and expression vector and engineering bacteria thereof

A technology of genetically engineered bacteria and apolipoproteins, applied in the field of DNA recombination for the production of proteins or polypeptides, can solve the problems of low expression amount, high expression cost, complicated purification steps, etc., to maintain biological activity, overcome instability, and simplify The effect of purification methods

Inactive Publication Date: 2010-12-22
DIASYS DIAGNOSTIC SYST SHANGHAI
View PDF2 Cites 5 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, in the commonly used 37°C E. coli expression process, the mRNA of apolipoprotein AI is extremely unstable, and the expressed recombinant apolipoprotein AI mature protein is easily degraded
It has been reported that when expressing apolipoprotein AI protein with this conventional Escherichia coli expression system, the yield is low due to the above reasons, and can only reach 4 mg / L culture liquid, which is not suitable for efficient and large-scale production of recombinant apolipoprotein AI protein
The use of other expression systems such as yeast, insect cells, and mammalian cell expression systems all have disadvantages such as complicated expression process, high expression cost, low expression amount, and cumbersome purification steps, which are also unfavorable for large-scale production.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Human apolipoprotein AI genetic engineering preparation method and expression vector and engineering bacteria thereof
  • Human apolipoprotein AI genetic engineering preparation method and expression vector and engineering bacteria thereof
  • Human apolipoprotein AI genetic engineering preparation method and expression vector and engineering bacteria thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0043] Example 1 PCR amplification of the coding gene of human apolipoprotein AI and construction of recombinant expression plasmid pCold-HuApoA1:

[0044] 1) PCR amplification of the target gene

[0045] ① Extraction of total RNA: Take fresh liver tissue from the patient, grind it with a homogenizer, and extract total RNA with an RNA extraction kit

[0046] ② RT-PCR: Using total RNA as a template, use a reverse transcription kit to obtain the eDNA of human apolipoprotein AI.

[0047] ③PCR amplification of the target gene: Design a pair of primers according to the human apolipoprotein AI sequence published in the gene bank. The primers are:

[0048] Upstream primer: 5'AAT CATATG GATGAACCCCCCCCAGAGCCCCT(NdeI)

[0049] Downstream primer: 5'AT AAGCTT CTGGGTGTTGAGCTTCTTAGTGTA(HindIII)

[0050] Referring to the reported human apolipoprotein AI sequence, the primers were designed from the 73rd nucleotide of cDNA, thereby artificially removing the signal peptide and precursor pept...

Embodiment 2

[0067] Large-scale expression and purification method of embodiment 2 gene recombinant bacteria

[0068] 1) Expression of recombinant human ApoA1-polyhistidine fusion protein in Escherichia coli host

[0069] ①Transform pCold-ApoA1 into Rosetta-gami Escherichia coli on LB plates with ampicillin resistance (100ng / ml), culture overnight at 37°C

[0070] ②Pick a single colony in 50ml LB culture containing 100μg / ml ampicillin at 37°C, 250 rpm, and culture overnight

[0071] ③ 2% inoculated into 1L 2YT medium (including 100ug / ml ampicillin), 37℃to A600, 0.D.0.5

[0072] ④Reduce the cultivation temperature to 10-20℃, and let the bacteria solution continue to cultivate for 30 minutes

[0073] ⑤ Add IPTG to a final concentration of 1mM 10°C, 300rpm induction culture for 15hours

[0074] ⑥Centrifuge at 4000rpm for 20 minutes at high speed, collect the precipitate and store it at -80°C

[0075] 2) Reagent for purifying recombinant human apolipoprotein AI-polyhistidine fusion protein...

Embodiment 3

[0096] Proof of Example 3 Recombinant Protein (15% SDS-acrylamide gel electrophoresis and Western blot method)

[0097] detailed steps:

[0098] 1) 15% SDS-acrylamide gel, through Tris-glycine buffer, 90V voltage, 3 hours electrophoresis, detect the finally obtained recombinant protein. The detection result shows that the specific band is consistent with the molecular weight of human apolipoprotein AI.

[0099] Figure 5A It is the result of electrophoresis of the total bacterial lysate of different expression host bacteria before affinity column purification. As shown by the electrophoresis results, the host bacteria BL21(DE3)PlysS, Roesetta-gami, and KS1000 transformed by the plasmid vector pCold containing the human apolipoprotein AI gene sequence were respectively induced by IPTG, compared with the samples before IPTG induction , an obvious difference band of induced protein can be seen at about 30KD, which is consistent with the expected molecular weight of human recom...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides a high efficiency soluble human apolipoprotein AI genetic engineering preparation method and expression vector and engineering bacteria thereof. Plasmid pCold containing recombinant human apolipoprotein AI gene sequence is selected as fusion expression vector, ApoA1 coding sequence is arranged between Nde I and Hind III endonuclease site on pCold vector. The engineering bacteria is escherichia coli, and the escherichia coli is converted into pCold-ApoA1 / Rosetta-gami by virtue of the expression vector plasmid pCold of the invention, and low temperature culture is carried out at 10-20 DEG C, thus inducing expression of soluble target protein. The invention adopts nickel crosslinking affinity column one-step method, operation is simple, yield is high, time is short, and the purity of the obtained target protein is higher than 90%, thus being applicable to industrialized mass production.

Description

technical field [0001] The present invention relates to the field of DNA recombination technology for producing protein or polypeptide in the field of biotechnology, in particular, relates to the genetic engineering preparation method of human apolipoprotein AI (Apolipoprotein I, ApoAl), and related expression vectors and engineering bacteria. Background technique [0002] With the improvement of people's living standards, the incidence of coronary atherosclerotic disease has increased significantly, and it has become one of the three major diseases that endanger human health. According to the research report of the United Nations Health Organization in 2002, about one-third of the death of patients in the world is related to cardiovascular disease (cardiovasculardisease). Among them, atherosclerotic cardiovascular disease bears the brunt. Atherosclerosis mainly damages the inner wall of the artery. This is because a large amount of membrane cholesteryl ester accumulates in...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C12N15/63C12N1/21C12N15/12C07K14/775C07K1/22C12R1/19
Inventor吴峻王荣芳张艳钱震斌
OwnerDIASYS DIAGNOSTIC SYST SHANGHAI