Tumor necrosis factor-related apoptosis-inducing ligand (TRAIL) fusion protein, its preparation and applications

A technology of fusion protein and protein, which is applied in the direction of antineoplastic drugs, peptide/protein components, biochemical equipment and methods, etc., and can solve the problems of short half-life and affecting the efficacy of TRAIL protein, etc.

Inactive Publication Date: 2011-11-23
JIANGSU SIMCERE PHARMACEUTICAL R & D CO LTD
View PDF6 Cites 10 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Although TRAIL has shown a significant inhibitory effect on tumor cell growth in in vivo and in vitro experiments and clinical experiments, its half-life is relatively short, and the half-life in the human body is only 40 minutes, which seriously affects the curative effect of TRAIL protein in vivo

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Tumor necrosis factor-related apoptosis-inducing ligand (TRAIL) fusion protein, its preparation and applications
  • Tumor necrosis factor-related apoptosis-inducing ligand (TRAIL) fusion protein, its preparation and applications
  • Tumor necrosis factor-related apoptosis-inducing ligand (TRAIL) fusion protein, its preparation and applications

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0055] Example 1. Construction of fusion protein expression vector

[0056] Using the leucine zipper (LZ, including cross-linking region and human leucine zipper domain) fragment synthesized by Shanghai Xuguan Biotechnology Development Co., Ltd. as a template, the required DNA fragment was amplified by PCR method. The primers used LZ1 and LZ2 were synthesized by Shanghai Sangon Bioengineering Technology Co., Ltd. Wherein the primer LZ2 not only contains the 3' end sequence of the LZ fragment, but also adds a sequence encoding a GlySer linker peptide after its 3' end.

[0057] LZ1: 5'CATGCCATGGCCCATATGGAGGAAGACCCGTGTGC

[0058] LZ2: 5'CGGGATCCGACAACTGTGTTTCCAGGATG

[0059] The TRAIL fragment is the 95th to 281st amino acid of the complete sequence of TRAIL, which is amplified from the cDNA library of human fetal liver bank (purchased from Clontech Lanoratories Inc.USA) by PCR method, and the primers TRAIL1 and TRAIL2 used are provided by Shanghai Sangong Bioengineering Techno...

Embodiment 2

[0064] Embodiment 2: Preparation of fusion protein

[0065] The Escherichia coli Rosetta clone transformed with the recombinant plasmid pET-LZ-TRAIL was cultured in a culture flask containing LB medium (37°C), and when the bacterial density reached OD600≈0.8, 1mM isopropyl-β- D-thiogalactoside (IPTG) induced expression. After about 6 hours, the bacterial cells were harvested at 5,000×g (30 minutes).

[0066] The harvested bacteria were resuspended in Tris buffer (pH 8.0), and the bacteria were disrupted by ultrasonication. After breaking the bacteria, centrifuge at 10,000×g for 30 minutes to collect the supernatant. The crushed supernatant obtained by the above method was applied to Ni sepharose 6 Fast flow (GE Company) for metal affinity chromatography, 40 mM imidazole was used to elute the impurity protein, and then 120 mM imidazole was used to elute the recombinant protein. The eluate was further purified by ion-exchange chromatography using Qsepharose Fast flow (GE Comp...

Embodiment 3

[0067] Embodiment 3: Drug efficacy experiment in vivo

[0068] Breast cancer cells MDA-MB231 were inoculated subcutaneously to establish a tumor-bearing nude mouse model, and experiments were carried out after the model was established. The experiment was divided into a negative control group, a positive control group (the extracellular region of the human TRAIL protein, the amino acid sequence of which is shown in SEQ ID NO: 6) and a test group (LZ-TRAIL). 6 nude mice in each group, the tumor tissue was inoculated to grow to 0.1cm3 and administered subcutaneously every day, according to equimolar dosage, the dosage was 300ug / mouse / time (TRAIL) and 450ug / mouse / time (LZ-TRAIL) respectively. ), administered 14 times in total. The nude mice were observed for 6 days after drug withdrawal, the tumors were peeled off and weighed, and the average tumor type and tumor inhibition rate of each group were calculated. The tumor inhibition rate was calculated by the following formula.

...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention, relating to the field of biotechnology, provides TRAIL fusion protein, a DNA sequence encoding the fusion protein, a vector containing the DNA sequence, a host cell or a transgenic animal containing the vector, a preparation method of the fusion protein and applications of the fusion protein. The TRAIL fusion protein from N-terminal to C-terminal comprises crosslinking region, humanized leucine zipper sequence and humanized TRAIL protein, humanized TRAIL extracellular region or fragments of humanized TRAIL extracellular region, can observably increase stability, prolong the half life in animal body and improve treatment effect, and has extensive application prospect.

Description

technical field [0001] The invention relates to the biological field, in particular to tumor necrosis factor-related apoptosis-inducing ligand fusion protein and its preparation and application in the medical field. Background technique [0002] Tumor is a kind of disease that seriously threatens human health and life, and the treatment of tumor has become a major public health problem that needs to be solved increasingly urgently. In recent years, although the research on antineoplastic drugs has made great progress, there are still defects such as poor pertinence and killing effect on normal cells, which greatly restricts their application. Therefore, the development of genetically engineered drugs that target and kill tumor cells still has significant social and economic benefits. [0003] In 1995, Wiley SR et al. reported that a gene encoding an anti-tumor protein was screened from a human expression tag sequence library (EST, expressed sequence tag). The protein encode...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C07K19/00C07K14/47C12N15/62C12N15/63C12N5/10C12N1/19C12N1/21A01K67/00C12P21/02A61K38/17A61K47/48A61P35/00A61P37/02C12R1/19
Inventor周兵周宇姜静
OwnerJIANGSU SIMCERE PHARMACEUTICAL R & D CO LTD