Bacterial strain capable of generating alginate lyase and fermentation method thereof

A technology of alginate lyase and bacterial strain, which is applied in the field of alginate lyase (ALG22) and its preparation, can solve the problems of lagging development of algae processing industry, few types of processed products, weak market competitiveness, etc., and achieve easy artificial cultivation and Effects of expanding cultivation, enriching diversity and selectivity, and highlighting salt tolerance

Inactive Publication Date: 2012-07-18
OCEAN RES CENT OF ZHOUSHAN ZHEJIANG UNIV
View PDF3 Cites 19 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0005] my country is rich in seaweed resources, and the cultivation of economic seaweeds such as kelp and seaweed is particularly developed, but the development of the algae processing industry is relatively lagging behind, with few types of processed products, low added value, and weak market competitiveness

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Bacterial strain capable of generating alginate lyase and fermentation method thereof
  • Bacterial strain capable of generating alginate lyase and fermentation method thereof
  • Bacterial strain capable of generating alginate lyase and fermentation method thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0040] Example 1: Strains Tamlana Isolation of sp. ZJU HZ22

[0041] Wild seaweed and surrounding seawater were collected from the Zhoushan area of ​​the East my country Sea. The algae were crushed under aseptic conditions, and transferred to a 500 ml sterile shaker bottle together with 200 ml seawater samples, and a small amount of sterile fresh kelp pieces and peptone (finally Concentration 1 g / l) and yeast extract (final concentration 1 g / l), continued cultivation at 28°C, 120 rpm, and observed changes in the turbidity of the culture medium and residual kelp. Replace natural seawater with oligotrophic 2216 medium, add appropriate amount of fresh kelp pieces (200 g / l), sterilize at 121°C for 30 min, and take 10% inoculum from the above-mentioned shake flask with kelp degradation effect Transfer, cultivate under the same conditions until the kelp is degraded, and repeat the transfer for 2-3 generations to obtain a bacterial population with a stable degradation effect. The a...

Embodiment 2

[0044] Example 2: Strains Tamlana Amplification, sequence determination and analysis of 16S rRNA gene of sp. ZJU HZ22 (CGMCC No. 5324)

[0045] Strain ZJU HZ22 was streaked on the 2216 slope and cultured at 28°C until a lawn was formed. Scrape a loop of bacteria from a sterile inoculation loop and place it in a 1.5 ml sterile centrifuge tube. Genomic DNA was extracted using the Bacterial Genome Rapid Extraction Kit (Dongsheng Biology) and used as a template for PCR. The general primers for amplifying the 16S rRNA gene are as follows:

[0046] Forward primer: 5'-AGAGTTTGATCCTGGCTCAG-3';

[0047] Reverse primer: 5'- ACGGTTACCTTGTTACGACTT -3';

[0048] The above primers correspond to bases 8-27 and bases 1510-1492 of the 16S rRNA gene of Escherichia coli respectively. 50 μl PCR reaction system: 5 μl 10×buffer, 1 μl 10 mM dNTPs, 1 μl each 4 μM primer, ddH 2 O 42 μL, Taq enzyme 0.5 μl (2.5 U), DNA template 0.5 μl (10-100 ng). The PCR reaction conditions were: denaturation at...

Embodiment 3

[0051] Example 3: Strains Tamlana Identification of morphological and physiological characteristics of sp. ZJU HZ22 (CGMCC No. 5324)

[0052] The strain ZJU HZ22 used for identification was all inoculated in 2216 medium, and 15 g / l agar could be added to prepare solid medium, and sterilized at 121°C for 30 min.

[0053] A single colony was obtained by streak culture on a plate, and at the same time, the colony was picked to prepare a bacterial suspension, and the microscopic examination was carried out on a glass slide. The results showed that the strain had the following morphological characteristics: (1) Colony morphology: the colony was round and the surface was smooth , waxy luster, raised, smooth-edged, translucent, bright yellow in color. (2) Cell morphology: Gram-negative bacteria, typical rod-shaped cells under the light microscope (Olympus, BX40), arranged singly, and split in the middle.

[0054] Using 2216 as the basal medium, the physiological characteristics we...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides a bacterial strain capable of generating alginate lyase and a fermentation method thereof. The bacterial strain capable of generating alginate lyase provided in the invention is classified as Tamlana sp., named as ZJU HZ22, assigned with the accession number of CGMCC No. 5324 and preserved on Oct. 14th, 2011. The bacterial strain is capable of background expression of alginate lyase under the condition of no inducing substrate and can improve the level of expression through stimulation of a substrate. The fermentation method provided in the invention is simple; the alginate lyase ALG22 generated by the bacterial strain CGMCC No. 5324 is lyoenzyme and has striking salt tolerance; fermentation broth of the alginate lyase can obtain substantial and stable enzyme activity after simple bacteria removal and can both be directly used in degradation of alginate and be easily further separated and purified; so the alginate lyase has application potential in degradation of alginate and preparation of alginate-derived oligosaccharide.

Description

technical field [0001] The invention belongs to microbial strains and applications thereof, and relates to a new marine bacterial strain Tamlana sp. ZJU HZ22, the strain preservation number is CGMCC No. 5324. The invention also relates to alginate lyase (ALG22) produced by fermentation of the strain and a preparation method thereof. Background technique [0002] Alginate is a general term for alginic acid, alginate and other derivatives. It is widely found in the cell walls of hundreds of brown algae such as kelp, sargassum, and macroalgae. It is mainly composed of 1, 4 – β – D – mannose Uronic acid (M) and 1, 4-α-L-guluronic acid (G) are polymerized from two uronic acid monomers. The polymerization forms include: forming homopolysaccharides in the form of poly M or poly G, Or in the form of poly MG (including M, G monomers one by one alternately polymerized or randomly polymerized in different proportions) to form heteropolysaccharides. [0003] Alginate lyase (alginate...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N1/20C12N9/88C12R1/01
Inventor张心齐柏超迟方涛郑刚吴敏
OwnerOCEAN RES CENT OF ZHOUSHAN ZHEJIANG UNIV