Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Expansion of application of penicillium lipase in biodiesel preparation

A biodiesel and lipase technology, applied in the field of bioengineering, can solve the problems of time-consuming and laborious, unclear goals, and inconspicuousness, and achieve the effects of high efficiency, clear breeding goals, and high biodegradability.

Inactive Publication Date: 2014-04-09
SHENZHEN LEVEKING BIOLOGY ENG
View PDF3 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, the traditional strain breeding method mainly relies on random physical and chemical mutagenesis, which has unclear goals, is time-consuming and laborious, and has no obvious results. At present, the use of these methods to improve the ability of the strain to produce lipase has been very limited and has little potential.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Expansion of application of penicillium lipase in biodiesel preparation

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0049] Embodiment 1, the construction of overexpression vector

[0050] Take the following steps:

[0051] (1) utilize restriction endonuclease Sac I, Kpn I to hygromycin resistance expression cassette from plasmid PV2 + The fragments were excised by the upper enzyme, and the fragments were recovered by gel, and cloned into the corresponding restriction site of the pCAMBIA2300 plasmid to obtain the recombinant plasmid pCHAMBIA2302 with hygromycin resistance; the hygromycin expression cassette can also be derived from any other DNA containing this sequence Or directly synthesized, the plasmid that is used to construct PEL gene overexpression vector except pCAMBIA2300, can also use the pCAMBIA series carrier such as pCAMBIA1300, pCAMBIA3300 etc. and pHB carrier that can express in filamentous fungus;

[0052] (2) According to the sequence design primer (forward primer: TG) of the lipase gene PEL (AF330635) of Penicillium expanded ACTAGT ATGTTGTTCAACTACCAATCTTT The underlined ...

Embodiment 2

[0058] Embodiment two, the acquisition of Penicillium genetically engineered bacteria

[0059] The acquisition of the Penicillium genetically engineered bacterium comprises the following steps:

[0060] (1) Pick the isolated and purified wild-type Penicillium and inoculate it on a PDA plate, cultivate it at 28°C for about 20 days, and wash the mature spores with sterile water;

[0061] (2) Inoculate the engineered Agrobacterium EHA105 containing the final vector pCHAMBIA2302::PgpdA-PEL-TtrpC in Example 1 in the LB liquid medium containing streptomycin and kanamycin (both 100 μg / ml) at 28°C, Cultivate overnight at 200 rpm, reactivate with MM medium containing streptomycin and kanamycin (both 100 μg / ml), and culture at 220 rpm for 48 hours at 28°C. Take an appropriate amount of culture and centrifuge at 5000rpm to remove the supernatant, wash with 1M liquid medium, and finally dilute to OD600=0.15 with 1M liquid medium, then cultivate at 28°C and 220rpm for 6-8 hours until OD60...

Embodiment 3

[0070] The application of the present invention is the transesterification reaction completed on the organic solvent oil-water interface, and the esterification rate of the transesterification synthesis can reach 85-95%.

[0071] The lipase used in the present invention is the modified Penicillium extensa lipase obtained by the present invention, and then adopts the method of immobilization treatment, wherein, the immobilization method comprises the following steps: adding enzyme powder in the buffer solution, stirring Make it fully dissolved, then add a certain amount of diatomaceous earth into the enzyme solution, shake at a constant temperature for a certain period of time, collect the solid by centrifugation, wash the immobilized carrier with acetone for 3-5 times to disperse the carrier particles, and then wash with distilled water for 3 -5 times, the acetone was washed away, and the immobilized lipase was obtained after freeze-drying.

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides a method for obtaining highly expressed lipase bacterial strain and an application of the highly expressed lipase obtained by the method in biodiesel production, the method comprises the following steps: a step of raw material pretreatment comprises the processes of filtering biolipid and removing the impurities, stirring for emulsification; a step of ester interchange reaction comprises the processes of adding grease and methanol or ethanol in a reaction container according to mol ratio of 1:1-3, then adding the modified expansion Penicillium lipase and an organic solvent, sealing and mixing for reacting for 6-24 hours under the reaction condition of 20-50 DEG C, adding methanol or ethanol again during the reaction process, wherein the mol ratio of methanol or ethanol to grease added in each time is 1-3:1; and a step of biodiesel acquisition comprises the processes of separating the lipase from a reactant after the reaction is completed, performing centrifugation for layering on the reaction products, standing and separating the crude glycerine at the lower layer, distilling the upper layer liquid, and recovering the organic solvent to obtain the finished product biodiesel.

Description

technical field [0001] The application of the present invention relates to the application of Penicillium extensa lipase in the preparation of biodiesel, which belongs to the technical field of bioengineering. Background technique [0002] In recent years, lipase (Lipase EC) has made great progress in industrial application. Alkaline lipase has the advantages of high substrate hydrolysis efficiency, mild reaction, non-toxicity, and ability to hydrolyze fat under certain conditions. It has been used in washing It has been widely used in the fields of pharmaceuticals, papermaking, tanning, food, textile and light industry, and has become an important variety in the global enzyme preparation market. [0003] Through the selection and breeding of a large number of microbial strains, a strain of P. expansium with strong ability to produce alkaline lipase has been obtained, and after years of mutation breeding and fermentation process improvement, its production The capacity of l...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12N15/80C12N9/20C12P7/64C10L1/02C12R1/83
CPCY02E50/13Y02E50/10
Inventor 王剑英陈健王宏兰瑛
Owner SHENZHEN LEVEKING BIOLOGY ENG
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com