Fusion protein of granulocyte colony-stimulating factor (g-csf) and its mutant (mg-csf) with the third domain of human serum albumin (3dhsa) and its application
A technology of colony stimulating factor and human serum albumin, which can be applied in the fields of extracellular fluid diseases, peptide/protein components, medical preparations with non-active ingredients, etc. immune response and other issues to ensure accuracy and reduce screening workload
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 13D
[0045] Cloning of embodiment 13DHSA-G-CSF and 3DHSA-mG-CSF fusion gene
[0046] For the amplification of 3DHSA-G10 and 3DHSA-mG10, the primers used are as follows:
[0047] P1: 5'TCT CTCGAG AAGAGAGTGGAAGAGCCTCAGAATTTAAT3' (with XhoI restriction site at the 5' end, CTCGAG), primer SEQNO:8.
[0048] P2: 5'CCAGCGGGGTTAAGCCTAAGGCAGCTTGAC3', primer SEQ NO:9.
[0049] P3: 5'ATGTGGGTGCTAAGCCTAAGGCAGCTTGAC3', primer SEQ NO:10.
[0050] The PCR method is as follows: Add 2 μL of 10 μmol / L upstream and downstream primers to the 50 μL system (the primers used to amplify 3DHSA-G10 are P1 and P2, and the primers used to amplify 3DHSA-mG10 are P1 and P3), 2.5 μmol / L dNTP 4 μL, 10 × Premistarbuffer 5 μL, 5 U / μL Premistar DNA polymerase 0.5 μL, pPICzαA-HSA-G-CSF plasmid (SEQNO: 7) 1 μL, the insufficient part was made up with sterilized double distilled water, the reaction conditions were: 94 ° C pre-denaturation for 5 min, 94 °C Denaturation at °C for 1 min, annealing at 56°C for 1 min, e...
Embodiment 2
[0060] The screening of embodiment 2 recombinant strains
[0061] The pPICzαA-3DHSA-G-CSF and pPICzαA-3DHSA-mG-CSF plasmids were extracted, linearized by SalI single enzyme digestion, the effect of the enzyme digestion was detected by agarose gel electrophoresis, and the enzyme digestion products were recovered with an agarose gel recovery kit. 1.5kV electroporation to transform Pichia pastoris GS115 competent cells, let stand at 30°C for 2h, spread the transformants evenly on 4 MD plates containing 1mol / L sorbitol, culture them upside down at 30°C for 3 days, and transfer the transformed clones Correspondingly marked and transferred to two newly prepared MD plates at the same time, cultured upside down at 30°C for 3 days, put the UV-irradiated PVDF membrane on the colony of one of the MD plates lightly, and place the UV-irradiated membrane on the membrane at the same time. 2 sheets of filter paper, soak the surface of the filter paper with 3mL of anhydrous methanol, continue ...
Embodiment 33D
[0062] Example 3 Induced expression and identification of 3DHSA-G-CSF and 3DHSA-mG-CSF fusion proteins
[0063] Inoculate the single colonies of GS115 / pPICzαA-3DHSA-G-CSF and GS115 / pPICzαA-3DHSA-mG-CSF screened into 100ml BMGY (0.3g dipotassium hydrogen phosphate, 1.18g potassium dihydrogen phosphate, 1.34g amino-free culture Base, 1g yeast powder, 2g peptone, 20μg biotin, 1mL glycerol, pH 6.0) in a 500ml Erlenmeyer flask, cultured at 220r / min, 30°C for 24h, centrifuged at 2000r / min for 5min, and collected the bacteria. Use 100ml of BMMY (0.3g dipotassium hydrogen phosphate, 1.18g potassium dihydrogen phosphate, 1.34g amino-free medium, 1g yeast powder, 2g peptone, 20μg biotin, 1mL anhydrous methanol, pH6.0) to resuspend the bacteria For precipitation, 1 mL of anhydrous methanol was added every 12 hours, and the induction continued for five days. Centrifuge at 8000r / min for 10min, collect the supernatant, and perform SDS-PAGE detection. The expression of the fusion protein in...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More