Recombinant protein PACAP38-NtA, and coding gene and application thereof
A recombinant protein, pacap38-nta technology, which is applied in the field of recombinant protein, can solve the problems of long repair time and large amount of use, and achieve the effect of good repair function, less use amount, and good effect of promoting corneal repair
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0054] Design the amino acid sequences of PACAP38-NtA protein and PACAP27-NtA, the sequences are as follows:
[0055] Amino acid sequence of PACAP38-NtA:
[0056] HSDGIFTDSYSRYRKQMAVKKYLAAVLGKRYKQRIKNKGSGGGSGGGGSGGGGSNCPERELQEEEEEANVVLTGTVEEIMNDVPVHHTYSCKVRVWRYLKGKDIVTHEILLDGGNKVVIGGFGDPLICDNQVSTGDFTTRIFFVNPAPQYMWPAHRNELMLNSSLMRITLRNLEEETPKVEEEKLL;
[0057] Amino acid sequence of PACAP27-NtA:
[0058] HSDGIFTDSYSRYRKQMAVKKYLAAVLGSGGGSGGGGSGGGGSNCPERELQEEEEEANVVLTGTVEEIMNDVPVHHTYSCKVRVWRYLKGKDIVTHEILLDGGNKVVIGGFGDPLICDNQVSTGDTRIFFVNPAPQYMWPAHRNELMLNSSLMRITLRNLEEVEHCVEEHRKLLPAKPNSYFTQTPNSYFTQTPS.
[0059] According to the codon preference of Escherichia coli, the nucleotide sequences are speculated as follows:
[0060] Nucleotide sequence encoding PACAP38-NtA:
[0061] CACTCTGACGGTATCTTCACCGACTCTTACTCTCGTTACCGTAAACAGATGGCTGTTAAAAAATACCTGGCTGCTGTTCTGGGTAAACGTTACAAACAGCGTATCAAAAACAAAGGTTCTGGTGGTGGTTCTGGTGGTGGTGGTTCTGGTGGTGGTGGTTCTAACTGCCCGGAACGTGAACTGCAGGAAGAAGAAGAAGAAGCTAACGTT...
Embodiment 2
[0080] Expression of fusion gene expression vectors pET-3c / PACAP38-NtA and pET-3c / PACAP27-NtA in Escherichia coli BL21 (DE3).
[0081] Inoculate Escherichia coli DH5α clones containing recombinant vectors pET-3c / PACAP38-NtA and pET-3c / PACAP27-NtA in liquid LB medium containing 50 μg / ml ampicillin and 34 μg / ml chloramphenicol, respectively, at 37°C After culturing for 12 hours, the plasmid DNA was extracted with the Omega plasmid extraction kit.
[0082] Transform the pET-3c / PACAP38-NtA and pET-3c / PACAP27-NtA plasmids into Escherichia coli BL21 (DE3) (purchased from Novagen) competent cells (the preparation method of the competent cells is the same as the ice CaCl mentioned above) 2 Law). During transformation, take 100 μg of the purified pET-3c / PACAP38-NtA and pET-3c / PACAP27-NtA plasmids as DNA samples to transform Escherichia coli BL21 (DE3), and the obtained expression strains are respectively denoted as PACAP38-NtA / BL21 (DE3) and PACAP27-NtA / BL21 (DE3). Keep the recombin...
Embodiment 3
[0089] Example 3 Fermentation and cultivation of recombinant protein in small-scale bioreactors
[0090] The PACAP38-NtA / BL21 (DE3) and PACAP27-NtA / BL21 (DE3) bacterial classifications obtained in Example 2 are respectively carried out the scale-up culture of shaking flask, promptly by volume percentage 2% inoculum size is inoculated in two 5mL containing 50 μ g / ml of liquid LB medium containing ampicillin and 34 μg / ml chloramphenicol, cultured on a shaker at 37°C for 12 hours, and then transferred to 300 mL containing 50 μg / ml ampicillin and 34 μg / ml chloramphenicol according to the volume percentage of 2% inoculum In the liquid LB medium (shake flask: 1000mL), culture at 37°C and 180rpm for 12h to obtain 300ml seed liquid.
[0091] Pour 3L of fermentation medium into the fermenter, install pH and dissolved oxygen electrodes on the fermenter, seal the outlet of the pipeline with cotton and tin foil, and sterilize at 121°C for 18 minutes. Seed feeding bottles, acid-base feed...
PUM
Property | Measurement | Unit |
---|---|---|
concentration | aaaaa | aaaaa |
concentration | aaaaa | aaaaa |
Abstract
Description
Claims
Application Information

- R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com